GARL3_DANRE

Ensembl ID:
ENSDARG00000060631
Description:
GTPase-activating Rap/Ran-GAP domain-like protein 3 [Source:UniProtKB/Swiss-Prot;Acc:A5PF44]
Human Orthologue:
GARNL3
Human Description:
GTPase activating Rap/RanGAP domain-like 3 [Source:HGNC Symbol;Acc:25425]
Mouse Orthologue:
Garnl3
Mouse Description:
GTPase activating RANGAP domain-like 3 Gene [Source:MGI Symbol;Acc:MGI:2139309]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9912 Nonsense Available for shipment Available now
sa40481 Essential Splice Site Mutation detected in F1 DNA During 2016
sa31462 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9912
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085636 Nonsense 262 870 10 25
Genomic Location (Zv9):
Chromosome 5 (position 35005545)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 32787494
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGGAAGAGACACATTGGGAACGACATCGTGACCATCGTGTTTCAGGAG[G/T]GAGATGACGYCTCGCCGTCCTTYAAACCCTCCATGATTCGCTCCCATTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40481
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085636 Essential Splice Site 370 870 14 25
Genomic Location (Zv9):
Chromosome 5 (position 35000084)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 32782033
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCAGACCCATGTTTATCTGTACTGCTCCTGTAGGTTCCCTTCTCTCCGC[A/T]GAACATGCTGAATCGACGCTCATTCAGCGATGTCCTGCCAGAGTCACCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31462
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085636 Nonsense 557 870 19 25
Genomic Location (Zv9):
Chromosome 5 (position 34989868)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 32771817
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCAGGCTGCCATCTCTACTCCATAAACACACATCATGGAGTGGAGCTC[A/T]GAATTGTTGCGGCGATAAGAAACAAGCTCCTTCTGATCACCAGGAAACAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link