HIP1R (2 of 2)

Ensembl ID:
ENSDARG00000060627
Description:
huntingtin interacting protein 1 related [Source:HGNC Symbol;Acc:18415]
Human Orthologue:
HIP1R
Human Description:
huntingtin interacting protein 1 related [Source:HGNC Symbol;Acc:18415]
Mouse Orthologue:
Hip1r
Mouse Description:
huntingtin interacting protein 1 related Gene [Source:MGI Symbol;Acc:MGI:1352504]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45417 Essential Splice Site Mutation detected in F1 DNA During 2018
sa38814 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45417
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085556 Essential Splice Site 285 1191 10 33
Genomic Location (Zv9):
Chromosome 10 (position 45625974)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 44607409
GRCz11 10 44478488
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGGAATCGAGTTCTTCAAAACCATCATTCAGATCCCTGATCTGCCCAAC[G/A]TGAGATCCTGATCACATCTCTGAAGCTTTCAAATCCCCCCCAAAAATAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38814
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085556 Essential Splice Site 346 1191 12 33
Genomic Location (Zv9):
Chromosome 10 (position 45624490)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 44605925
GRCz11 10 44477004
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTATGGGTTCAACCAGTTTGATTATCCAGTCGATGTACCGGAGCAAAGG[T/A]AACAAACACATTTTATTTAGTATTTTTAACAGAAATTTTCATTCTTAAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Parkinson's disease: Imputation of sequence variants for identification of genetic risks for Parkinson's disease: a meta-analysis of genome-wide association studies. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link