HIP1R (2 of 2)

Ensembl ID:
ENSDARG00000060627
Description:
huntingtin interacting protein 1 related [Source:HGNC Symbol;Acc:18415]
Human Orthologue:
HIP1R
Human Description:
huntingtin interacting protein 1 related [Source:HGNC Symbol;Acc:18415]
Mouse Orthologue:
Hip1r
Mouse Description:
huntingtin interacting protein 1 related Gene [Source:MGI Symbol;Acc:MGI:1352504]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38814 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38814
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085556 Essential Splice Site 346 1191 12 33
Genomic Location (Zv9):
Chromosome 10 (position 45624490)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 44605925
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTATGGGTTCAACCAGTTTGATTATCCAGTCGATGTACCGGAGCAAAGG[T/A]AACAAACACATTTTATTTAGTATTTTTAACAGAAATTTTCATTCTTAAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Parkinson's disease: Imputation of sequence variants for identification of genetic risks for Parkinson's disease: a meta-analysis of genome-wide association studies. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link