NP_001038780.1

Ensembl ID:
ENSDARG00000060626
Description:
diacylglycerol kinase alpha [Source:RefSeq peptide;Acc:NP_001038780]
Human Orthologue:
DGKA
Human Description:
diacylglycerol kinase, alpha 80kDa [Source:HGNC Symbol;Acc:2849]
Mouse Orthologue:
Dgka
Mouse Description:
diacylglycerol kinase, alpha Gene [Source:MGI Symbol;Acc:MGI:102952]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17147 Essential Splice Site Available for shipment Available now
sa29975 Nonsense Mutation detected in F1 DNA During 2017
sa8725 Nonsense Mutation detected in F1 DNA During 2017
sa16576 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17147
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085642 Essential Splice Site 371 727 13 24
ENSDART00000134883 Essential Splice Site 320 676 10 21
ENSDART00000143013   None 90 None 3
Genomic Location (Zv9):
Chromosome 23 (position 32488851)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 32323741
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATGATGACAGTGAGCTCAACACCACACCTGATGGRCAGGTGCTGCGGG[T/C]AGGACTCTGATAYATCTCTACWACTGCATCCACACACKGAAYGATGAGRG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29975
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085642 Nonsense 388 727 14 24
ENSDART00000134883 Nonsense 337 676 11 21
ENSDART00000143013   None 90 None 3
Genomic Location (Zv9):
Chromosome 23 (position 32488717)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 32323607
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATCAGCCCCATTCCAGACACTCGTCCTCTTTTGGTGTTTGTCAATCCT[A/T]AAAGTGGAGGTAAACAGGGAGAAAGGTGAGAACACGTATATCCATCTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8725
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085642 Nonsense 422 727 16 24
ENSDART00000134883 Nonsense 371 676 13 21
ENSDART00000143013   None 90 None 3
Genomic Location (Zv9):
Chromosome 23 (position 32487238)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 32322128
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACTTGAAGGTGGTCATAATCGATTTAATACTCTGTTTTCAAACCAGGT[T/A]GAGTTTCTTCAGAGACGTGCCGAATTACAGAATATTAGTTTGCGGAGGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16576
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085642 Nonsense 522 727 18 24
ENSDART00000134883 Nonsense 471 676 15 21
ENSDART00000143013   None 90 None 3
Genomic Location (Zv9):
Chromosome 23 (position 32484923)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 32319813
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATACAGGTGACTCTGGAGGACAGTCAGGAGAGAGGAGACCCTGTGCCCTA[C/A]GAAATCATCAAMAACTATTTCTCCATCGGAGTGGTGAGACTYGTAGAGTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Vitiligo: Association analyses identify three susceptibility Loci for vitiligo in the Chinese Han population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link