lig4

Ensembl ID:
ENSDARG00000060620
ZFIN ID:
ZDB-GENE-070820-10
Description:
DNA ligase 4 [Source:RefSeq peptide;Acc:NP_001096593]
Human Orthologue:
LIG4
Human Description:
ligase IV, DNA, ATP-dependent [Source:HGNC Symbol;Acc:6601]
Mouse Orthologue:
Lig4
Mouse Description:
ligase IV, DNA, ATP-dependent Gene [Source:MGI Symbol;Acc:MGI:1335098]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38268 Nonsense Mutation detected in F1 DNA During 2016
sa13669 Nonsense Available for shipment Available now
sa32694 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa38268
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085648 Nonsense 762 909 2 2
Genomic Location (Zv9):
Chromosome 1 (position 28201366)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 28466793
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACATGATCCACATGTCACCTTCCACAAGGGAACACTTCGCTAAAGAGTA[T/A]GATCAGTATGGAGACAGTTATTACGTTGACACTAGTGAACAGCAGCTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13669
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085648 Nonsense 764 909 2 2
Genomic Location (Zv9):
Chromosome 1 (position 28201370)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 28466797
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATCCACATGTCACCTTCCACAAGGGAACACTTYGCTAAAGAGTATGAT[C/T]AGTATGGAGACAGTTATTACGTTGACACTAGTGAACAGCAGCTGAGGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32694
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085648 Nonsense 776 909 2 2
Genomic Location (Zv9):
Chromosome 1 (position 28201406)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 28466833
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAAAGAGTATGATCAGTATGGAGACAGTTATTACGTTGACACTAGTGAA[C/T]AGCAGCTGAGGGATGTCATTGAAAGGATCAGCTCCGCAGAAGTCAAGAGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link