lig4

Ensembl ID:
ENSDARG00000060620
ZFIN ID:
ZDB-GENE-070820-10
Description:
DNA ligase 4 [Source:RefSeq peptide;Acc:NP_001096593]
Human Orthologue:
LIG4
Human Description:
ligase IV, DNA, ATP-dependent [Source:HGNC Symbol;Acc:6601]
Mouse Orthologue:
Lig4
Mouse Description:
ligase IV, DNA, ATP-dependent Gene [Source:MGI Symbol;Acc:MGI:1335098]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13669 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13669
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085648 Nonsense 764 909 2 2
Genomic Location:
Chromosome 1 (position 28201370)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATCCACATGTCACCTTCCACAAGGGAACACTTYGCTAAAGAGTATGAT[C/T]AGTATGGAGACAGTTATTACGTTGACACTAGTGAACAGCAGCTGAGGGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/j3ujmas3