si:dkey-104n16.1

Ensembl ID:
ENSDARG00000060610
ZFIN ID:
ZDB-GENE-081104-299
Description:
Novel protocadherin protein [Source:UniProtKB/TrEMBL;Acc:B0UX50]
Human Orthologue:
PCDH7
Human Description:
protocadherin 7 [Source:HGNC Symbol;Acc:8659]
Mouse Orthologue:
Pcdh7
Mouse Description:
protocadherin 7 Gene [Source:MGI Symbol;Acc:MGI:1860487]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14558 Nonsense Available for shipment Available now
sa9185 Nonsense Mutation detected in F1 DNA During 2017
sa2374 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa14558
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085612 Nonsense 347 1101 1 2

The following transcripts of ENSDARG00000060610 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 64102254)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 63016695
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCTTGATGAGAGCACTGGCTGGCTCAGTGTTTTGCACCGAATTGATCGT[G/T]AAGATGTGAGCCAGCTTCGTTTCACAGTCATGGCACGTGACCGTGGTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9185
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085612 Nonsense 676 1101 1 2

The following transcripts of ENSDARG00000060610 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 64103241)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 63017682
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAACAACACAGGTACCATTTTCTCAAACATGGCTTTTGATCGTGAGCAA[A/T]GAAACAATTATTCATTCCGTGTCAAAGCTGTTGATGGTGGCGATCCACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2374
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085612 Nonsense 1051 1101 2 2

The following transcripts of ENSDARG00000060610 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 64233535)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 63147976
KASP Assay ID:
554-3085.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGACCTTCTCGGTGGTGAGCCAACCCCAGGACCCGCACCAGGGCTCGCTG[C/T]AGAGTTGCTACGACAGTGGCYTGGAGGAGTCGGAGACGCCCAGCAGCAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Lipid traits: A genome-wide screen for interactions reveals a new locus on 4p15 modifying the effect of waist-to-hip ratio on total cholesterol. (View Study)
  • Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link