rgs7bpa

Ensembl ID:
ENSDARG00000060601
ZFIN ID:
ZDB-GENE-060929-380
Description:
Regulator of G-protein signaling 7-binding protein A [Source:UniProtKB/Swiss-Prot;Acc:Q08BU8]
Human Orthologue:
RGS7BP
Human Description:
regulator of G-protein signaling 7 binding protein [Source:HGNC Symbol;Acc:23271]
Mouse Orthologue:
Rgs7bp
Mouse Description:
regulator of G-protein signalling 7 binding protein Gene [Source:MGI Symbol;Acc:MGI:106334]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21336 Essential Splice Site Available for shipment Available now
sa31663 Nonsense Available for shipment Available now
sa1911 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa21336
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085573 Essential Splice Site 48 248 None 6

The following transcripts of ENSDARG00000060601 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 32762614)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 31905340
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGCCTGTACTTTCTTAGCTTGTTTGCCTTTGTTTTCCTCTCTTCCAAA[A/G]GGTTGTCCAGGAGTTCAATACACTTGTGGCCCTCTATAGGGAGTTGGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31663
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085573 Nonsense 213 248 5 6

The following transcripts of ENSDARG00000060601 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 32754796)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 31897522
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGACAGAAATGAAAAATCTGCTAAGCAAACTCAGGGAGACAATGCCTT[T/A]ACCGCTGAAGAACCAAGGTAATGTTCACTTACACAAGTTCCCTCGCTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1911
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085573 Essential Splice Site 219 248 5 6

The following transcripts of ENSDARG00000060601 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 32754777)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 31897503
KASP Assay ID:
554-1901.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCTAAGCAAACTCAGGGAGACAATGCCTTTACCGCTGAAGAACCAAGG[T/C]AATGTTCACTTACACAAGTTCSCTCGCTGATATTACAGACTAATTCACTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link