BAIAP2 (2 of 2)

Ensembl ID:
ENSDARG00000060587
Description:
BAI1-associated protein 2 [Source:HGNC Symbol;Acc:947]
Human Orthologue:
BAIAP2
Human Description:
BAI1-associated protein 2 [Source:HGNC Symbol;Acc:947]
Mouse Orthologue:
Baiap2
Mouse Description:
brain-specific angiogenesis inhibitor 1-associated protein 2 Gene [Source:MGI Symbol;Acc:MGI:2137336

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12233 Nonsense Available for shipment Available now
sa38901 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa12233
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085523 Nonsense 17 559 1 15
Genomic Location:
Chromosome 12 (position 38143503)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATTAGTATAACTGCTGCTGTGGTGTTGACAAAATCTGTGTTGTTTCTGT[T/A]GCAGTCCATCATGGAGCAGTTCAAYCCTTGCTTRAGGAACTTTGTTGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38901
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085523 Nonsense 130 559 5 15
Genomic Location:
Chromosome 12 (position 38118138)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTCGTCTGGCAGGCAGCTCTGAAGAAATATCAGATGGAACACAAAAGT[A/T]AAGGAGAAAGTCTGGAGAAATGCCAGGCCGAGCTGAAGAAACTGCGCAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link