ctdspl2b

Ensembl ID:
ENSDARG00000060586
ZFIN ID:
ZDB-GENE-030131-1809
Description:
CTD small phosphatase-like protein 2-B [Source:UniProtKB/Swiss-Prot;Acc:A4QNX6]
Human Orthologue:
CTDSPL2
Human Description:
CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2 [Source:HGN
Mouse Orthologue:
Ctdspl2
Mouse Description:
CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2 Gene [Sourc

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40925 Nonsense Mutation detected in F1 DNA During 2017
sa34098 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa40925
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085505 Nonsense 229 460 6 13
ENSDART00000130822 Nonsense 229 460 5 12
Genomic Location (Zv9):
Chromosome 7 (position 32720611)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 31114951
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATGTGTTGTTGTTTTTTCAGCTCCTGGCTCTCCTGCAACAGGGGGCTA[T/A]GTGGATGCTTCTATCACTGTCCCAGCTGAAGGATCATATGAGGAGGAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34098
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085505 Essential Splice Site 288 460 7 13
ENSDART00000130822 Essential Splice Site 288 460 6 12
Genomic Location (Zv9):
Chromosome 7 (position 32721344)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 31115684
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTCTGAAGACACGAAGCACTCCTGAGTTCTCCCTGGTGCTTGACTTGG[T/G]CAGTAAAACATCGCATGAGACTGGTGTACTCACACTAGGCACAGTTAAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link