sec24c

Ensembl ID:
ENSDARG00000060575
ZFIN IDs:
ZDB-GENE-030131-4487, ZDB-GENE-030131-4487
Description:
Sec24 family member C [Source:UniProtKB/TrEMBL;Acc:D5LHQ7]
Human Orthologue:
SEC24C
Human Description:
SEC24 family, member C (S. cerevisiae) [Source:HGNC Symbol;Acc:10705]
Mouse Orthologue:
Sec24c
Mouse Description:
Sec24 related gene family, member C (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1919746]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22150 Nonsense Available for shipment Available now
sa31889 Nonsense Available for shipment Available now
sa35346 Nonsense Mutation detected in F1 DNA During 2017
sa17715 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22150
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085476 Nonsense 20 1241 1 22
ENSDART00000109159 Nonsense 20 1142 2 24
Genomic Location (Zv9):
Chromosome 12 (position 35748533)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 35473212
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCAGCAACCTCACATGGCCTCTCCTTATGGGCAACCTCAGCCAGGGTA[T/A]CAGCGCTACCCTCAGCCTGGGTATCAGCGCTACCCTCAGCCAGGGTATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31889
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085476 Nonsense 92 1241 2 22
ENSDART00000109159 Nonsense 92 1142 3 24
Genomic Location (Zv9):
Chromosome 12 (position 35753286)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 35468453
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGAACCCCCCACCTCAGGGACACCACCTGTCTCAGGTGCCCAGAGCTA[T/A]TCGCAGTTTGGCCAAGGAGAGACTCAAAATGGACCACCTCCAATGGTAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35346
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085476 Nonsense 602 1241 8 22
ENSDART00000109159 Nonsense 503 1142 10 24
Genomic Location (Zv9):
Chromosome 12 (position 35763784)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 35458073
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATTGAAGGTGGCCGTCGTTTCCAGTGTGGCTTCTGCAGCTGTGTCACC[G/T]AGGGTTGGTTTTGCTGCCATAACAGGATTATCATTTTGGATTCATCAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17715
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085476 Essential Splice Site 874 1241 14 22
ENSDART00000109159 Essential Splice Site 775 1142 16 24
Genomic Location (Zv9):
Chromosome 12 (position 35766594)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 35455283
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTGCCCACTTCAACAGGCGGCTCSATCWATAAGTACACCTACTTYCAGG[T/C]ATAGAAGAAYTGCATCTGAGTCACCATAACCATACAAGAGCAGCTAAACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link