si:ch73-263b18.1

Ensembl ID:
ENSDARG00000060567
ZFIN ID:
ZDB-GENE-100922-231
Human Orthologue:
TRPM2
Human Description:
transient receptor potential cation channel, subfamily M, member 2 [Source:HGNC Symbol;Acc:12339]
Mouse Orthologue:
Trpm2
Mouse Description:
transient receptor potential cation channel, subfamily M, member 2 Gene [Source:MGI Symbol;Acc:MGI:1

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34783 Nonsense Mutation detected in F1 DNA During 2017
sa38766 Essential Splice Site Mutation detected in F1 DNA During 2017
sa21609 Nonsense Available for shipment Available now
sa34781 Nonsense Available for shipment Available now
sa34780 Nonsense Mutation detected in F1 DNA During 2017
sa14804 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34783
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085351 Nonsense 8 1421 1 39
ENSDART00000136940 Nonsense 4 290 1 6
Genomic Location (Zv9):
Chromosome 9 (position 54745621)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 53380699
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGACCCTTGTGCAAACACTCGCGGTGAGCACTGCTAAAGGCGGCCGATA[T/A]CTGTCTCTGTCTCCCTCTTTCCAGCGCTGCTCACTCGCCTCCTGGATTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38766
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085351 Essential Splice Site 302 1421 None 39
ENSDART00000136940   290 290 None 6
Genomic Location (Zv9):
Chromosome 9 (position 54728895)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 53363973
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATACCAGTGGTCTGTGTGGTTCTGGACGGCGGTCCGGGAACTCTAAATG[T/A]GAGTTTTTCAAGTCATCAGCTTTTTTTAAAACAGTATTTCTAGATTGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21609
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085351 Nonsense 391 1421 8 39
ENSDART00000136940   None 290 None 6
Genomic Location (Zv9):
Chromosome 9 (position 54616096)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 53357307
KASP Assay ID:
2260-2600.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGATGCCTCATTTGCTCACAGTATTCCGCATCGATGAGGATAAAAACTA[T/A]GACGTGGATGTGGCCATTCTGCAGGCGCTGCTAAAAGGTATTGCTTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34781
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085351 Nonsense 896 1421 22 39
ENSDART00000136940   None 290 None 6
Genomic Location (Zv9):
Chromosome 9 (position 54489618)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 53332605
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGACTTCATCATATTCTGCCTGCGATTAATGGCCATCTTCTCCATCAGT[C/T]GAACTCTGGGTCCCAAAATAATCATCGTCAGGAGAATGGTGGGTTTGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34780
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085351 Nonsense 931 1421 23 39
ENSDART00000136940   None 290 None 6
Genomic Location (Zv9):
Chromosome 9 (position 54488337)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 53331324
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTCATGTTTCTGCTCAGTATCTGGGTTGTGGCGTACGGAGTAGCCAAA[C/T]AGGGCATTCTGATCGAAAACGAAGAGAGACTAAACTGGATCATCCGTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14804
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085351 Nonsense 1388 1421 38 39
ENSDART00000136940   None 290 None 6

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 54460882)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 53304048
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGCGCAGGTGCTGGAGAGGATTCTGGGTAAAAAGTTAAATGAAAAGACC[A/T]AGACTCTTCTAAAAGCTGGAGAAGAGGTGAGCATGGYAAACGCAAAASAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link