si:ch211-274p24.5

Ensembl ID:
ENSDARG00000060566
ZFIN ID:
ZDB-GENE-091113-48
Human Orthologue:
KIAA0664
Human Description:
KIAA0664 [Source:HGNC Symbol;Acc:29094]
Mouse Orthologue:
1300001I01Rik
Mouse Description:
RIKEN cDNA 1300001I01 gene Gene [Source:MGI Symbol;Acc:MGI:1921398]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37364 Nonsense Mutation detected in F1 DNA During 2018
sa43702 Essential Splice Site Mutation detected in F1 DNA During 2018
sa45746 Nonsense Mutation detected in F1 DNA During 2018
sa43703 Nonsense Mutation detected in F1 DNA During 2018
sa39343 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa37364
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085453 Nonsense 233 1658 1 26
ENSDART00000140940   None 823 None 14
Genomic Location (Zv9):
Chromosome 21 (position 38196599)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 39316678
GRCz11 21 39361736
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAACAGGACAAAAAGAAACTAAACGAAAGTGGTCCAAACAGTGCAGCA[C/T]AAGCACATCTAGATGCGATAAAGATGCAACCTGCTTATGGCATTCCAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43702
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085453 Essential Splice Site 451 1658 None 26
ENSDART00000140940 Essential Splice Site 47 823 None 14
Genomic Location (Zv9):
Chromosome 21 (position 38200926)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 39321005
GRCz11 21 39366063
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCACAGTCAAGATCCAGGCTCCTGGAACAGAACCAAGAGACTTCCAGG[T/C]AAAACCCAGGCTTGTCCCTCAGAAAAGCTTTCCACTCTTGAGCTACTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45746
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085453 Nonsense 617 1658 6 26
ENSDART00000140940 Nonsense 213 823 5 14
Genomic Location (Zv9):
Chromosome 21 (position 38207568)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 39327647
GRCz11 21 39372705
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTCAGAGTGCTTGAAGGTTTTGGCCTCGAGTAGCTGGAATCCTCCGCCT[G/T]GAAACAGAAAGATGCACGGAGACCTGATGTATCTGAACGTGGTCACTATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43703
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085453 Nonsense 769 1658 9 26
ENSDART00000140940 Nonsense 365 823 8 14
Genomic Location (Zv9):
Chromosome 21 (position 38210773)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 39330852
GRCz11 21 39375910
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACAAGGGAGCTTCCAAGAAAAAACGTAACAGACCGCCTGATAAGGGAT[C/T]GAGCCATTTTCAAGGTATCCTTAAACTCTTGACATGTTTAATTTACAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39343
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085453 Nonsense 1120 1658 13 26
ENSDART00000140940 Nonsense 716 823 12 14
Genomic Location (Zv9):
Chromosome 21 (position 38221837)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 39341916
GRCz11 21 39386974
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAAACAGAAACAGCAGTTAAAGGATGCAGCGAGTTTCCTCATTTCCTA[T/G]CAGATCCCTGCATTTGTAAGTATGGGGATTTCAGAAATGTGACAGATGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link