LOC565173

Ensembl ID:
ENSDARG00000060551
Human Orthologue:
RPS6KA5
Human Description:
ribosomal protein S6 kinase, 90kDa, polypeptide 5 [Source:HGNC Symbol;Acc:10434]
Mouse Orthologue:
Rps6ka5
Mouse Description:
ribosomal protein S6 kinase, polypeptide 5 Gene [Source:MGI Symbol;Acc:MGI:1920336]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6491 Essential Splice Site Mutation detected in F1 DNA During 2014
sa23140 Nonsense Mutation detected in F1 DNA During 2014
sa15790 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6491
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085438 Essential Splice Site 193 802 5 17
Genomic Location:
Chromosome 17 (position 38597159)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AYGGTCACATTGTGTTGACGGATTTTGGTCTAAGTAAGGAATTTCATGAG[G/A]TAAGTTTGCTTGCAGAAATCTTTTGCAATTTTTAGTWACTGACAGCTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23140
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085438 Nonsense 362 802 10 17
Genomic Location:
Chromosome 17 (position 38581821)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTTTTCTGTTTGCCAGTGTGTTTATAGATGTTTGTGTCTGCAGGGCTA[T/G]TCCTTCATGGCTCCCTCTATCCTGTTCAAGAGGAACGCGGTGATGGATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15790
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085438 Nonsense 575 802 14 17
Genomic Location:
Chromosome 17 (position 38567919)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACCTCCTGACAATCAGCTCCTGAAGACCCCCTGCTTCACTCTTCAGTA[T/A]GCCGCACCAGAAATCCTCAAATACAGTGGTTAYGACGAGTCCTGCGACCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bone mineral density: Genome-wide meta-analysis identifies 56 bone mineral density loci and reveals 14 loci associated with risk of fracture. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rh7xwupg