LOC565173

Ensembl ID:
ENSDARG00000060551
Human Orthologue:
RPS6KA5
Human Description:
ribosomal protein S6 kinase, 90kDa, polypeptide 5 [Source:HGNC Symbol;Acc:10434]
Mouse Orthologue:
Rps6ka5
Mouse Description:
ribosomal protein S6 kinase, polypeptide 5 Gene [Source:MGI Symbol;Acc:MGI:1920336]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6491 Essential Splice Site Mutation detected in F1 DNA During 2016
sa28901 Essential Splice Site Mutation detected in F1 DNA During 2016
sa23140 Nonsense Mutation detected in F1 DNA During 2016
sa36479 Essential Splice Site Mutation detected in F1 DNA During 2016
sa36478 Nonsense Mutation detected in F1 DNA During 2016
sa15790 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6491
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085438 Essential Splice Site 193 802 5 17
Genomic Location (Zv9):
Chromosome 17 (position 38597159)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 38482056
KASP Assay ID:
554-4927.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AYGGTCACATTGTGTTGACGGATTTTGGTCTAAGTAAGGAATTTCATGAG[G/A]TAAGTTTGCTTGCAGAAATCTTTTGCAATTTTTAGTWACTGACAGCTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28901
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085438 Essential Splice Site 360 802 9 17
Genomic Location (Zv9):
Chromosome 17 (position 38583769)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 38468666
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACATACTCGCCAGCAGCACTTCCAAACAACTGTGACCGCATCTTCCAGG[T/C]AGTGCAATTAATGGATAATATTATTGTGTAATATGAGTTGTGTAATGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23140
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085438 Nonsense 362 802 10 17
Genomic Location (Zv9):
Chromosome 17 (position 38581821)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 38466718
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTTTTCTGTTTGCCAGTGTGTTTATAGATGTTTGTGTCTGCAGGGCTA[T/G]TCCTTCATGGCTCCCTCTATCCTGTTCAAGAGGAACGCGGTGATGGATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36479
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085438 Essential Splice Site 402 802 10 17
ENSDART00000085438 Essential Splice Site 402 802 10 17
Genomic Location (Zv9):
Chromosome 17 (position 38581699)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 38466596
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCAGAAAGGCCGGGCTCTGCTGCTGTTGCCCGTAGCGCTATGATGAAGG[T/C]CAGTCTGCATAATCCTGTGTTGTAAGAAAAAACAAAACATTGCAACATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36478
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085438 Nonsense 482 802 13 17
Genomic Location (Zv9):
Chromosome 17 (position 38569306)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 38454203
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTAGACCCTCTAACGGGGTGATTTTCTGTTTGTTTAGCTGCACACATA[T/A]CTTGTCCTGGAACTCTTGCGAGGTGGTGAGCTTCTGGAGCGGATCAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15790
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085438 Nonsense 575 802 14 17
Genomic Location (Zv9):
Chromosome 17 (position 38567919)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 38452816
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACCTCCTGACAATCAGCTCCTGAAGACCCCCTGCTTCACTCTTCAGTA[T/A]GCCGCACCAGAAATCCTCAAATACAGTGGTTAYGACGAGTCCTGCGACCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bone mineral density: Genome-wide meta-analysis identifies 56 bone mineral density loci and reveals 14 loci associated with risk of fracture. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link