LOC100332538

Ensembl ID:
ENSDARG00000060549
Human Orthologue:
ECEL1
Human Description:
endothelin converting enzyme-like 1 [Source:HGNC Symbol;Acc:3147]
Mouse Orthologue:
Ecel1
Mouse Description:
endothelin converting enzyme-like 1 Gene [Source:MGI Symbol;Acc:MGI:1343461]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1132 Nonsense F2 line generated During 2014
sa17034 Essential Splice Site Available for shipment Available now
sa10946 Nonsense Available for shipment Available now
sa7412 Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa1132
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085387 Nonsense 78 683 1 17
Genomic Location:
Chromosome 15 (position 47346441)
KASP Assay ID:
554-1043.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGATACCAGAGGATAAACTGAGCTAYGGGATTATCACTGCTATTGGAGAA[C/T]AAAACCAGGACAAACTGCAGCGCCTCCTACAGGCACCGGTGCAGAGGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17034
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085387 Essential Splice Site 191 683 2 17
Genomic Location:
Chromosome 15 (position 47348583)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTYACCGTCAGCGTAGACGACAAAAACTCWTCACGCAACGCCATACGR[G/A]TGAGAGAACACACTTCTGACTGTGTTTATTACAATATTGTTATCAGTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10946
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085387 Nonsense 306 683 6 17
Genomic Location:
Chromosome 15 (position 47361467)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGACCGCATCTTCAACGWTAATTTCTCTGAGGAGGAGGAGATTGTGGTTT[T/A]GGCCACTGACTAYATGCARACGGTGTCGGACAKCATCAAAACCACCTCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7412
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085387 Missense 664 683 17 17
Genomic Location:
Chromosome 15 (position 47392088)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGTGTATGAAGAGAAGATCTCAGTCCATCTACCTGCAGCTGCTGACRG[A/T]TAAACACGCACCTGAGCATTRCAGGTACTGCATTCATCAATACACACGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/k3ym1c5c