lgr4

Ensembl ID:
ENSDARG00000060542
Human Orthologue:
LGR4
Human Description:
leucine-rich repeat-containing G protein-coupled receptor 4 [Source:HGNC Symbol;Acc:13299]
Mouse Orthologue:
Lgr4
Mouse Description:
leucine-rich repeat-containing G protein-coupled receptor 4 Gene [Source:MGI Symbol;Acc:MGI:1891468]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa183 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa183
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085419 Nonsense 163 971 5 18
Genomic Location:
Chromosome 7 (position 33769289)
KASP Assay ID:
554-0098.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTGCCGGAGGACAGTTTTGAGGGTCTGCAGCAGCTCAGGCACCTCTGGT[T/A]GGATGACAACAGCCTGACTGAGGTTCCCATCAGCCCCTTGCAGCACCAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ytznd7nu