OCRL (1 of 2)

Ensembl ID:
ENSDARG00000060541
Description:
oculocerebrorenal syndrome of Lowe [Source:HGNC Symbol;Acc:8108]
Human Orthologue:
OCRL
Human Description:
oculocerebrorenal syndrome of Lowe [Source:HGNC Symbol;Acc:8108]
Mouse Orthologue:
Ocrl
Mouse Description:
oculocerebrorenal syndrome of Lowe Gene [Source:MGI Symbol;Acc:MGI:109589]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22515 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22515
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085402 Essential Splice Site 249 952 7 23
ENSDART00000144715 Essential Splice Site 250 953 7 23
Genomic Location (Zv9):
Chromosome 14 (position 34821277)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 33507792
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAAAGAAAGGCCACCATCTGTACAAAATGCCACACCTGTCAGAAATGAG[T/A]AAGTGCTACTGGTCTTAAATGCAGAAACTTGTGGATTTTCAGAAACTGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link