SHANK1 (1 of 3)

Ensembl ID:
ENSDARG00000060539
Description:
SH3 and multiple ankyrin repeat domains 1 [Source:HGNC Symbol;Acc:15474]
Human Orthologue:
SHANK1
Human Description:
SH3 and multiple ankyrin repeat domains 1 [Source:HGNC Symbol;Acc:15474]
Mouse Orthologue:
Shank1
Mouse Description:
SH3/ankyrin domain gene 1 Gene [Source:MGI Symbol;Acc:MGI:3613677]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20034 Nonsense Available for shipment Available now
sa33198 Nonsense Mutation detected in F1 DNA During 2017
sa40086 Nonsense Mutation detected in F1 DNA During 2017
sa33197 Nonsense Mutation detected in F1 DNA During 2017
sa40085 Nonsense Mutation detected in F1 DNA During 2017
sa20033 Nonsense Available for shipment Available now
sa40084 Nonsense Mutation detected in F1 DNA During 2017
sa33196 Nonsense Mutation detected in F1 DNA During 2017
sa12603 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20034
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085327 Nonsense 36 1695 1 33
Genomic Location (Zv9):
Chromosome 3 (position 30921246)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30639285
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGCAGTCTGACTGAGTCTCTGAGGGATGTTTTAAACTATGGTCTTTTT[C/T]AACCTGCCACTGACGGGCACGATGCCAAGTTCCTGGAGGAGGAGAGGCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33198
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085327 Nonsense 183 1695 5 33
Genomic Location (Zv9):
Chromosome 3 (position 30909760)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30627799
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGTTCAAATTAAAATGTAATCCCGTGTCTTCTACTGTTCAGACGCTGT[T/A]GTCTTTGGGGGCGTCTTCTGATTATAAGGACAGCCGTGGGCTGACACCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40086
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085327 Nonsense 274 1695 6 33
Genomic Location (Zv9):
Chromosome 3 (position 30908100)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30626139
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATCCCAGAATGCCTCAGGAAACACTGCCCTGCACATATGTGCTTTATA[T/G]AACAAGGTATAACCACTGCACCTTACACACAAAAACAAAGCAAATATTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33197
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085327 Nonsense 460 1695 12 33
Genomic Location (Zv9):
Chromosome 3 (position 30900622)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30618661
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCTACAGCGCCGTTCCTGGCCGAGTTTTTGTTGCCACTCGCTCACACT[C/A]GGCCCAGGGTGACCGCGAAATCAGCTTCAACAAGGGAGACAAAGTCAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40085
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085327 Nonsense 522 1695 14 33
Genomic Location (Zv9):
Chromosome 3 (position 30897158)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30615197
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGGATGCGGTTGTGTTTGCATCTTTCAGAGAGCCGCAGTGAGAGAGCC[A/T]AGAGACTCTTCCGGCATTATACTGTTGGATCCTACGACAGCTTCGATGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20033
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085327 Nonsense 846 1695 21 33
Genomic Location (Zv9):
Chromosome 3 (position 30856123)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30574162
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCTATGTCTCAGTCTACTTCCTCTGCTGCACATTATCAACTCTACTCA[C/T]AGTCAGTACATGTTACTCACGGACCAAGGGACAGGTCCCCTGGACCACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40084
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085327 Nonsense 1022 1695 25 33
Genomic Location (Zv9):
Chromosome 3 (position 30855262)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30573301
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACTCAGACTTCTCAACAGCAGCTGAGTTCCCAGCCTTCACCACGCCTG[C/T]GACCATCCAAATCTATAGATGAAGGCATGTTCTCAGGTGATACTTTTATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33196
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085327 Nonsense 1388 1695 29 33
Genomic Location (Zv9):
Chromosome 3 (position 30853216)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30571255
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATGCACAATGCCAAAGCCGCTAGCACTGCATCCACCTACCCAAAAACA[C/T]AGAGGTACAGAGAAGGCACCCGGGCTGGAGATCTTCGACGCCAGACCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12603
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085327 Nonsense 1640 1695 33 33
Genomic Location (Zv9):
Chromosome 3 (position 30851563)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30569602
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTGCCTCAAAACCTCTCCCATACTGGACCAAGTATGATGTTGCAGATT[G/A]GCTGGGCTACCTGAACCTGGGTGAACAMAGGGAGCGATTCTTAGACAATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link