si:ch211-188i4.3

Ensembl ID:
ENSDARG00000060534
ZFIN IDs:
ZDB-GENE-090313-59, ZDB-GENE-090319-2, ZDB-GENE-090319-2
Description:
Novel protein similar to H.sapiens SGPP1, sphingosine-1-phosphate phosphatase 1 (SGPP1) [Source:UniP
Human Orthologue:
SGPP1
Human Description:
sphingosine-1-phosphate phosphatase 1 [Source:HGNC Symbol;Acc:17720]
Mouse Orthologue:
Sgpp1
Mouse Description:
sphingosine-1-phosphate phosphatase 1 Gene [Source:MGI Symbol;Acc:MGI:2135760]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa28174 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa28174
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085421 Nonsense 225 437 2 3
ENSDART00000141420 Nonsense 211 423 2 3
Genomic Location (Zv9):
Chromosome 13 (position 37897569)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37374381
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATATAACAAAATGTGTGTGTTCATTTTATTTTTATTTTTCCCCACAGTA[T/G]CCCATGTTGCTGGGTCTCTCTCTGGCCATCAGCTGGTGTGTCCTGGTGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link