A7YYF5_DANRE

Ensembl ID:
ENSDARG00000060532
Description:
Zgc:173905 protein [Source:UniProtKB/TrEMBL;Acc:A7YYF5]
Human Orthologue:
ADAM22
Human Description:
ADAM metallopeptidase domain 22 [Source:HGNC Symbol;Acc:201]
Mouse Orthologue:
Adam22
Mouse Description:
a disintegrin and metallopeptidase domain 22 Gene [Source:MGI Symbol;Acc:MGI:1340046]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6446 Essential Splice Site Mutation detected in F1 DNA During 2014
sa14978 Nonsense Available for shipment Available now
sa19148 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6446
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085376 Essential Splice Site 35 237 3 9
ENSDART00000125590 Essential Splice Site 206 918 8 31
Genomic Location:
Chromosome 16 (position 46077742)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACACACACTATATTCAGTTCTCCTTACTAATATTTTAGNTTTTTTTTTAC[A/T]GTTCATCTGGCAGAGTCACTTTTTGAAAACCCTCCATTGTTCAGTGCCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14978
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085376 None None 237 None 9
ENSDART00000125590 Nonsense 478 918 17 31
Genomic Location:
Chromosome 16 (position 46099566)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTKTTCTGCAGGAGTGTGCTAAAGAGGGGGAAAACTGCTGCAAAAAATG[T/A]ATGTTGACTCAGGGAGCCAAATGCAGTGATGGTCTCTGTTGTAAAAACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19148
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085376 None None 237 None 9
ENSDART00000125590 Essential Splice Site 496 918 17 31
Genomic Location:
Chromosome 16 (position 46099621)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACTCAGGGAGCCAAATGCAGTGATGGTCTCTGTTGTAAAAACTGCCAG[G/A]TAGGTGCTGAGTCATACAAGAAAGAAAAAAAAAAGTGCAGCTGTTTCTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jtkg1s1l