nkx6.3

Ensembl ID:
ENSDARG00000060529
ZFIN ID:
ZDB-GENE-070810-7
Description:
homeobox protein Nkx-6.3 [Source:RefSeq peptide;Acc:NP_001159612]
Human Orthologue:
NKX6-3
Human Description:
NK6 homeobox 3 [Source:HGNC Symbol;Acc:26328]
Mouse Orthologue:
Nkx6-3
Mouse Description:
NK6 homeobox 3 Gene [Source:MGI Symbol;Acc:MGI:1921811]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25403 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25403
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085395 Nonsense 172 272 2 3
ENSDART00000125516 Nonsense 173 273 4 5
ENSDART00000132718 Nonsense 26 123 1 2
Genomic Location (Zv9):
Chromosome 8 (position 39505794)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 38384597
KASP Assay ID:
554-7626.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACCTACATTCAGTGGGCATCAGATCTTTGCTCTGGAGAAAACCTTTGAA[C/T]AGACCAAGTATTTGGCAGGACCAGAGAGAGCCAGACTGGCATACTCGCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link