LOC100332262

Ensembl ID:
ENSDARG00000060521
Human Orthologue:
RBM27
Human Description:
RNA binding motif protein 27 [Source:HGNC Symbol;Acc:29243]
Mouse Orthologue:
Rbm27
Mouse Description:
RNA binding motif protein 27 Gene [Source:MGI Symbol;Acc:MGI:2147194]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31753 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31753
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085365 Nonsense 607 760 14 20
Genomic Location (Zv9):
Chromosome 9 (position 56350816)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 54764206
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTACTGGCATAGAGAACCCACAGCCAACACACAGGAGCAGGGACCCAGT[C/T]AGAGCACAAACCCTGGACAACAACATCCCCCAACACACAAGGTTTGTCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link