antxr2a

Ensembl ID:
ENSDARG00000060520
ZFIN ID:
ZDB-GENE-060526-14
Description:
anthrax toxin receptor 2a [Source:RefSeq peptide;Acc:NP_001038174]
Human Orthologue:
ANTXR2
Human Description:
anthrax toxin receptor 2 [Source:HGNC Symbol;Acc:21732]
Mouse Orthologue:
Antxr2
Mouse Description:
anthrax toxin receptor 2 Gene [Source:MGI Symbol;Acc:MGI:1919164]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15951 Essential Splice Site Available for shipment Available now
sa8427 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa15951
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085359 Essential Splice Site 153 478 5 18
ENSDART00000085367 Essential Splice Site 153 478 5 17
Genomic Location:
Chromosome 5 (position 41068883)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACTGATGGAAAGCTTGAAACGTATATCCATCAAYTCACTATWGAYGAGG[T/G]GAGTTGCTTTCTAACACTTGATATRTTGTCAATTTATGGCAATAAATGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8427
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085359 Nonsense 426 478 15 18
ENSDART00000085367 Nonsense 426 478 15 17
Genomic Location:
Chromosome 5 (position 41026969)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACAAGAGGAATCAGAAGAACCCATGGTCAAAAAGCCAAGARCACCTGCA[C/T]AAACRTGCCATCAATCTGAATCCAAGTGGTATACACCAATCAGAGTGAGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/q6my19zu