LOC100003277

Ensembl ID:
ENSDARG00000060512
Human Orthologue:
KBTBD3
Human Description:
kelch repeat and BTB (POZ) domain containing 3 [Source:HGNC Symbol;Acc:22934]
Mouse Orthologue:
Kbtbd3
Mouse Description:
kelch repeat and BTB (POZ) domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:1916399]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6403 Nonsense Mutation detected in F1 DNA During 2014
sa2795 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa6403
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085339 Nonsense 148 595 3 3
Genomic Location:
Chromosome 15 (position 46803457)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGATKTGTCCAACTGTCTGCATCTGCTGGAGCTGGCGGAGGGATACGGTT[C/A]GACACAGCTGCTGCGYGGCGCCATCGACTTCATCACGCAGAACTTCCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2795
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085339 Nonsense 258 595 3 3
Genomic Location:
Chromosome 15 (position 46803786)
KASP Assay ID:
554-2746.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTAACCGACGAATGCAGGAACATGCTAACWCATGCGCTAGCACAAACA[C/T]AGCAGTTCAGCGGGTTATTCACAGATGCTCGCGTGTCAACGACRTCCACG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1t5iq20s