cul4b

Ensembl ID:
ENSDARG00000060510
ZFIN ID:
ZDB-GENE-041008-208
Description:
cullin-4B [Source:RefSeq peptide;Acc:NP_001116316]
Human Orthologue:
CUL4B
Human Description:
cullin 4B [Source:HGNC Symbol;Acc:2555]
Mouse Orthologue:
Cul4b
Mouse Description:
cullin 4B Gene [Source:MGI Symbol;Acc:MGI:1919834]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14313 Nonsense Available for shipment Available now
sa19087 Essential Splice Site Available for shipment Available now
sa2747 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa14313
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085295 Nonsense 199 885 3 21
Genomic Location:
Chromosome 14 (position 34466179)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTACACAAATGAGACCTGGCAGAAACTAAAGGAGGCAGTAGAGGCCATA[C/T]AGAACAGCACTTCAATAAAGTACAATCTAGAGGAGCTCTATCAGGTCGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19087
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085295 Essential Splice Site 672 885 16 21
Genomic Location:
Chromosome 14 (position 34474622)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGCTATTGGCCAACATACGTCCCTATGGAAGTACATCTGCCAGCAGAG[G/T]TCAGTTCTGAGAAATATGTAGGGATGTAGCGATTCACCATGAGCCGGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2747
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085295 Nonsense 883 885 21 21
Genomic Location:
Chromosome 14 (position 34479582)
KASP Assay ID:
554-2792.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACAGGGACTACATGGAAAGGGATAARGAGAATCCCAATCAATACAACTA[T/A]GTGGCTTAGAGAGAAAGAGAGAGTNNNNNNNNGAGAGACAAAAGAAGAGTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/643xnp80