LOC570106

Ensembl ID:
ENSDARG00000060504
Human Orthologue:
PFKL
Human Description:
phosphofructokinase, liver [Source:HGNC Symbol;Acc:8876]
Mouse Orthologue:
Pfkl
Mouse Description:
phosphofructokinase, liver, B-type Gene [Source:MGI Symbol;Acc:MGI:97547]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15186 Nonsense Available for shipment Available now
sa21608 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15186
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085284 Nonsense 52 780 2 22
Genomic Location:
Chromosome 9 (position 54291901)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGTGACACGAATGGGCATCTATGTRGGCGCCAAGGTCTATCTGGTGTA[C/A]GAGGTATTCAAAAACACYGATGAAAGCCTTTCAAATGCTAAATGTGTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21608
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085284 Nonsense 96 780 4 22
Genomic Location:
Chromosome 9 (position 54281238)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGAGGAACAGTGATTGGCAGTGCCCGCTGTAAAGCATTCACCATGCGT[G/T]AGGGCCGGTTAGCGGCAGCATTTAACCTGGTGAAGCGTGGCATCTCTAAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Rheumatoid arthritis: The human AIRE gene at chromosome 21q22 is a genetic determinant for the predisposition to rheumatoid arthritis in Japanese population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ykkt4gz3