dpcd

Ensembl ID:
ENSDARG00000060501
ZFIN ID:
ZDB-GENE-060825-166
Description:
Protein DPCD [Source:UniProtKB/Swiss-Prot;Acc:Q0P448]
Human Orthologue:
DPCD
Human Description:
deleted in primary ciliary dyskinesia homolog (mouse) [Source:HGNC Symbol;Acc:24542]
Mouse Orthologue:
Dpcd
Mouse Description:
deleted in primary ciliary dyskinesia Gene [Source:MGI Symbol;Acc:MGI:1924407]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13585 Essential Splice Site Available for shipment Available now
sa38273 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa13585
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085309 Essential Splice Site 49 200 2 6
ENSDART00000142296 Essential Splice Site 49 139 2 5
Genomic Location (Zv9):
Chromosome 1 (position 31111035)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 30924495
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCAATGAGATGGCTGAGGAGTATGACCTAAAAACAGATGAGCTTGTCAG[T/A]AAGTGTTTTCWGTCTTGGCTTCATCCGAGCAAATAAAAAAANGAATTCWTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38273
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085309 Nonsense 129 200 4 6
ENSDART00000142296 Nonsense 129 139 4 5
Genomic Location (Zv9):
Chromosome 1 (position 31110599)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 30924059
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTACAGTGTGACAGCTGAGCCAATGGAAAGATGTTGTGTCATTCGGACCT[C/A]GAACAAAAAGTAAGTTAATATTAATAAGAGGTTTTAAATGATCATTTATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link