si:ch211-67f24.10

Ensembl ID:
ENSDARG00000060500
ZFIN IDs:
ZDB-GENE-090313-127, ZDB-GENE-090319-6
Description:
L-2-hydroxyglutarate dehydrogenase, mitochondrial [Source:RefSeq peptide;Acc:NP_001139067]
Human Orthologue:
L2HGDH
Human Description:
L-2-hydroxyglutarate dehydrogenase [Source:HGNC Symbol;Acc:20499]
Mouse Orthologue:
L2hgdh
Mouse Description:
L-2-hydroxyglutarate dehydrogenase Gene [Source:MGI Symbol;Acc:MGI:2384968]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42255 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42255
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085298 Essential Splice Site 235 452 6 10
Genomic Location (Zv9):
Chromosome 13 (position 37073908)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 36546210
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTATTTTTGTTTAGGGCAGAAATACCCCATCATCATCAGAAGCTCTCAG[G/A]TGAGAAATGAATGTGTGTGTGAATCTTGCATTTGAAGTGCTTTATTTGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link