CACNA1H (1 of 3)

Ensembl ID:
ENSDARG00000060496
Description:
calcium channel, voltage-dependent, T type, alpha 1H subunit [Source:HGNC Symbol;Acc:1395]
Human Orthologue:
CACNA1H
Human Description:
calcium channel, voltage-dependent, T type, alpha 1H subunit [Source:HGNC Symbol;Acc:1395]
Mouse Orthologue:
Cacna1h
Mouse Description:
calcium channel, voltage-dependent, T type, alpha 1H subunit Gene [Source:MGI Symbol;Acc:MGI:1928842

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20094 Nonsense Mutation detected in F1 DNA During 2014
sa16182 Essential Splice Site Available for shipment Available now
sa16069 Essential Splice Site Available for shipment Available now
sa8140 Essential Splice Site Mutation detected in F1 DNA During 2014
sa17053 Nonsense Available for shipment Available now
sa1124 Essential Splice Site F2 line generated During 2014
sa17795 Essential Splice Site Available for shipment Available now
sa10926 Essential Splice Site Available for shipment Available now
sa13577 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20094
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085210 Nonsense 556 2114 8 36
Genomic Location:
Chromosome 3 (position 39874013)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCAAATACAGGACATGAGGTGATACAGGACTTTGACAAGCTGCACCAG[C/T]AAATTGAAGCACATAGTAAGTTTTTTTTTTTTTAATTGCCGTTGTTTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16182
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085210 Essential Splice Site 690 2114 11 36
ENSDART00000085210 Essential Splice Site 690 2114 11 36
Genomic Location:
Chromosome 3 (position 39902235)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCTGTGGTCTGCAGAAGGTAATGAGGTGTGGCTGTGTTTCCYTTCACA[G/A]CCCGAGGAGCTGACMAACATCCTGGAGATCAGCAACATCGTCTTCACTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16069
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085210 Essential Splice Site 690 2114 11 36
ENSDART00000085210 Essential Splice Site 690 2114 11 36
Genomic Location:
Chromosome 3 (position 39902235)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCTGTGGTCTGCAGAAGGTAATGAGGTGTGGCTGTGTTTCCYTTCACA[G/A]CCCGAGGAGCTGACMAACATCCTGGAGATCAGCAACATCGTCTTCACTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8140
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085210 Essential Splice Site 1144 2114 18 36
Genomic Location:
Chromosome 3 (position 39915783)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAAAGATCATGAGGAATGGTCACTTTACCTGTTCTCTCCTCATAACAAG[T/A]ACGTAATTGTCCTGATATCATTTTACCACTWTACTTAAGTGCATTTTTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17053
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085210 Nonsense 1341 2114 23 36
Genomic Location:
Chromosome 3 (position 39919369)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAACATCACCAATAAGTCTGACTGTCTTCRGGCAAACCTCAAATGGATC[A/T]GAAGAAAGTACAATTTTGACAACTTGGGACAGGYACTGTTTTCCTCAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1124
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085210 Essential Splice Site 1351 2114 23 36
Genomic Location:
Chromosome 3 (position 39919403)
KASP Assay ID:
554-1035.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACCTCAAATGGATCAGAAGAAAGTACAATTTTGACAACTTGGGACAGG[T/C]ACTGTTTTCCTCAGATATCATTCATAGATTTTATATTTACATTTAGTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17795
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085210 Essential Splice Site 1601 2114 29 36
Genomic Location:
Chromosome 3 (position 39937114)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTACAGGCATGAGATCCCTACTCGACACCGTAATGCAAGCTTTACCACAG[G/A]TACCTGTTGTCTGTTTTATATTCAKTTATTMAAATGTGTAWATTKGGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10926
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085210 Essential Splice Site 1668 2114 31 36
Genomic Location:
Chromosome 3 (position 39940488)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YGACACTTTTCCGAGTATCAACTGGGGACAATTGGAATGGRATAATGAAG[G/A]TAAACTACAACACAGAAGTGCTAACTGTTTTCTATTGGTGCCATTTTAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13577
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085210 Nonsense 2107 2114 36 36
Genomic Location:
Chromosome 3 (position 39945655)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGAAAAAGTTGTCGGATAGCATGTTACTGCGGAGGAGGACACCATCCTA[T/G]GACCTGGCCCTGCAGCGGGACTCTYTGGACTTGCCGGAGAACCAGCTGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/lijxry0l