CACNA1H (1 of 3)

Ensembl ID:
ENSDARG00000060496
Description:
calcium channel, voltage-dependent, T type, alpha 1H subunit [Source:HGNC Symbol;Acc:1395]
Human Orthologue:
CACNA1H
Human Description:
calcium channel, voltage-dependent, T type, alpha 1H subunit [Source:HGNC Symbol;Acc:1395]
Mouse Orthologue:
Cacna1h
Mouse Description:
calcium channel, voltage-dependent, T type, alpha 1H subunit Gene [Source:MGI Symbol;Acc:MGI:1928842

Alleles

There are 11 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33265 Nonsense Mutation detected in F1 DNA During 2016
sa20094 Nonsense Available for shipment Available now
sa16182 Essential Splice Site Available for shipment Available now
sa16069 Essential Splice Site Available for shipment Available now
sa33266 Nonsense Mutation detected in F1 DNA During 2016
sa17053 Nonsense Available for shipment Available now
sa1124 Essential Splice Site F2 line generated During 2016
sa40132 Essential Splice Site Mutation detected in F1 DNA During 2016
sa17795 Essential Splice Site Available for shipment Available now
sa10926 Essential Splice Site Available for shipment Available now
sa13577 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33265
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085210 Nonsense 251 2114 6 36
Genomic Location (Zv9):
Chromosome 3 (position 39867281)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39730641
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACAGGCAACTACAGCTGTGTGAACTGGAACCAGTATTACAGTGAATGC[A/T]AGCCCGGAGACTTAAACCCGCACAAAGGCGCAGTAAACTTTGATAACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20094
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085210 Nonsense 556 2114 8 36
Genomic Location (Zv9):
Chromosome 3 (position 39874013)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39737373
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCAAATACAGGACATGAGGTGATACAGGACTTTGACAAGCTGCACCAG[C/T]AAATTGAAGCACATAGTAAGTTTTTTTTTTTTTAATTGCCGTTGTTTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16182
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085210 Essential Splice Site 690 2114 11 36
ENSDART00000085210 Essential Splice Site 690 2114 11 36
Genomic Location (Zv9):
Chromosome 3 (position 39902235)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39765595
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCTGTGGTCTGCAGAAGGTAATGAGGTGTGGCTGTGTTTCCYTTCACA[G/A]CCCGAGGAGCTGACMAACATCCTGGAGATCAGCAACATCGTCTTCACTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16069
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085210 Essential Splice Site 690 2114 11 36
ENSDART00000085210 Essential Splice Site 690 2114 11 36
Genomic Location (Zv9):
Chromosome 3 (position 39902235)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39765595
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCTGTGGTCTGCAGAAGGTAATGAGGTGTGGCTGTGTTTCCYTTCACA[G/A]CCCGAGGAGCTGACMAACATCCTGGAGATCAGCAACATCGTCTTCACTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33266
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085210 Nonsense 810 2114 13 36
Genomic Location (Zv9):
Chromosome 3 (position 39904793)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39768153
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTTTATTTTTTCTTTTGTCTGTAAAGCATACTCGGAATGCATCTGTTC[G/T]GATGCAAATTCAGCCTGAAGATGGAGAATGGAGACACTATTCCGGACAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17053
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085210 Nonsense 1341 2114 23 36
Genomic Location (Zv9):
Chromosome 3 (position 39919369)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39782729
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAACATCACCAATAAGTCTGACTGTCTTCRGGCAAACCTCAAATGGATC[A/T]GAAGAAAGTACAATTTTGACAACTTGGGACAGGYACTGTTTTCCTCAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1124
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085210 Essential Splice Site 1351 2114 23 36
Genomic Location (Zv9):
Chromosome 3 (position 39919403)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39782763
KASP Assay ID:
554-1035.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACCTCAAATGGATCAGAAGAAAGTACAATTTTGACAACTTGGGACAGG[T/C]ACTGTTTTCCTCAGATATCATTCATAGATTTTATATTTACATTTAGTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40132
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085210 Essential Splice Site 1533 2114 27 36
Genomic Location (Zv9):
Chromosome 3 (position 39931433)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39794793
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCTGCTTAAACTCGTGGCATTTGGAATACGGAGATTCTTCAAAGACAG[G/A]TATTGGAACCTATATGGATCTTTAAACACCTAATATGGCCAATCTAATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17795
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085210 Essential Splice Site 1601 2114 29 36
Genomic Location (Zv9):
Chromosome 3 (position 39937114)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39800474
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTACAGGCATGAGATCCCTACTCGACACCGTAATGCAAGCTTTACCACAG[G/A]TACCTGTTGTCTGTTTTATATTCAKTTATTMAAATGTGTAWATTKGGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10926
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085210 Essential Splice Site 1668 2114 31 36
Genomic Location (Zv9):
Chromosome 3 (position 39940488)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39803848
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YGACACTTTTCCGAGTATCAACTGGGGACAATTGGAATGGRATAATGAAG[G/A]TAAACTACAACACAGAAGTGCTAACTGTTTTCTATTGGTGCCATTTTAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13577
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085210 Nonsense 2107 2114 36 36
Genomic Location (Zv9):
Chromosome 3 (position 39945655)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 39809015
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGAAAAAGTTGTCGGATAGCATGTTACTGCGGAGGAGGACACCATCCTA[T/G]GACCTGGCCCTGCAGCGGGACTCTYTGGACTTGCCGGAGAACCAGCTGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link