eprs

Ensembl ID:
ENSDARG00000060494
ZFIN ID:
ZDB-GENE-030131-638
Description:
LOC562037 protein [Source:UniProtKB/TrEMBL;Acc:A8WG07]
Human Orthologue:
EPRS
Human Description:
glutamyl-prolyl-tRNA synthetase [Source:HGNC Symbol;Acc:3418]
Mouse Orthologue:
Eprs
Mouse Description:
glutamyl-prolyl-tRNA synthetase Gene [Source:MGI Symbol;Acc:MGI:97838]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23149 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23149
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075743 Essential Splice Site 925 1683 19 34
Genomic Location:
Chromosome 17 (position 39890940)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAACAGGGGGAGCTGGTCAGAAAGCTAAAAGCAGAGAAAGCACCAAAA[G/A]TGAGATCACACTTCTTTTTGATCTGTTGTTTGTTGTGTAATTATTGTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pfws1g4w