eprs

Ensembl ID:
ENSDARG00000060494
ZFIN ID:
ZDB-GENE-030131-638
Description:
LOC562037 protein [Source:UniProtKB/TrEMBL;Acc:A8WG07]
Human Orthologue:
EPRS
Human Description:
glutamyl-prolyl-tRNA synthetase [Source:HGNC Symbol;Acc:3418]
Mouse Orthologue:
Eprs
Mouse Description:
glutamyl-prolyl-tRNA synthetase Gene [Source:MGI Symbol;Acc:MGI:97838]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44876 Nonsense Mutation detected in F1 DNA During 2017
sa23149 Essential Splice Site Available for shipment Available now
sa36487 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44876
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075743 Nonsense 663 1683 16 34
Genomic Location (Zv9):
Chromosome 17 (position 39886104)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTCTCCAGATAGAGGAGAAGATGATAGGAGACCCTTGTTTGAAAGACT[T/A]GAAGAAAGGTGACATCATACAGCTGCAAAGACGGGGTTTCTATATCTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23149
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075743 Essential Splice Site 925 1683 19 34
Genomic Location (Zv9):
Chromosome 17 (position 39890940)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 39775837
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAACAGGGGGAGCTGGTCAGAAAGCTAAAAGCAGAGAAAGCACCAAAA[G/A]TGAGATCACACTTCTTTTTGATCTGTTGTTTGTTGTGTAATTATTGTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36487
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075743 Nonsense 1033 1683 21 34
Genomic Location (Zv9):
Chromosome 17 (position 39896135)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 39781032
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTAAAACAGTTGCTGAACCTTAAAGCTGAATACAAACAGCAAACTGGA[C/T]AGGAGTACAAACCAGGTGCACCTCCTTCATCTGGTTCTGCCACTGCACAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link