atl1

Ensembl ID:
ENSDARG00000060481
ZFIN ID:
ZDB-GENE-030131-8003
Description:
atlastin-1 [Source:RefSeq peptide;Acc:NP_001139172]
Human Orthologue:
ATL1
Human Description:
atlastin GTPase 1 [Source:HGNC Symbol;Acc:11231]
Mouse Orthologue:
Atl1
Mouse Description:
atlastin GTPase 1 Gene [Source:MGI Symbol;Acc:MGI:1921241]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4519 Essential Splice Site Mutation detected in F1 DNA During 2014
sa5865 Essential Splice Site Mutation detected in F1 DNA During 2014
sa24941 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4519
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085230 Essential Splice Site 95 559 2 14
ENSDART00000111832 Essential Splice Site 95 554 2 13
ENSDART00000146696 Essential Splice Site 93 136 2 3
Genomic Location:
Chromosome 13 (position 37173820)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGGCAAATCCTTCCTCATGGACTTCATGCTGCGCTACATGTACAGCCAG[G/A]TCAGGTTGTCWTAAAGTGCTGGTTCACCCAAAAAGGAAAATGATGTTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5865
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085230 Essential Splice Site 175 559 4 14
ENSDART00000111832 Essential Splice Site 175 554 4 13
ENSDART00000146696 None None 136 None 3
Genomic Location:
Chromosome 13 (position 37177100)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGACTCAGCTACTGTATTCGCCCTCAGTACCATGATCAGCTCTATGCAGG[T/C]TTTACATTCACAACACTGCACAAATATCACCCCCAAAATAAGTGAAGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24941
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085230 Essential Splice Site 242 559 7 14
ENSDART00000111832 Essential Splice Site 242 554 7 13
ENSDART00000146696 None None 136 None 3
Genomic Location:
Chromosome 13 (position 37177845)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTTATGGACAGGAAGGAGGAATGAAATTTCTGGAGAAAAGATTAAAAG[T/A]AAGTCTATGGAATCATGGAAATGTCAGGAGGATTTACACCAGGATTTTGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/lf8iaqcu