ubr1

Ensembl ID:
ENSDARG00000060480
ZFIN ID:
ZDB-GENE-091110-2
Description:
LOC568531 protein [Source:UniProtKB/TrEMBL;Acc:A2RV49]
Human Orthologue:
UBR1
Human Description:
ubiquitin protein ligase E3 component n-recognin 1 [Source:HGNC Symbol;Acc:16808]
Mouse Orthologue:
Ubr1
Mouse Description:
ubiquitin protein ligase E3 component n-recognin 1 Gene [Source:MGI Symbol;Acc:MGI:1277977]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23151 Nonsense Mutation detected in F1 DNA During 2014
sa23152 Nonsense Mutation detected in F1 DNA During 2014
sa23153 Nonsense Mutation detected in F1 DNA During 2014
sa23154 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23151
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085223 Nonsense 266 870 7 25
Genomic Location:
Chromosome 17 (position 39983291)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTTATGGCAGGGGCGAAGAGCAGTGAAAAGAGGGACTCTCAGAACCTG[T/A]CAACAAGCCAAGGACAATATCAGGGTAATCATAACTCACTTACATTTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23152
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085223 Nonsense 482 870 13 25
Genomic Location:
Chromosome 17 (position 39990883)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCCAGGTACATTCTAATCAGCAAGCCGTCTATTTGGACCGAGGCATTA[C/T]GAGTGAAGTTCCTCGAAGGTTTTCGCGTCTTTCTTCACTTTCTCGGCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23153
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085223 Nonsense 807 870 23 25
Genomic Location:
Chromosome 17 (position 40005011)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTTTTGTTGTTGTTTTAGGAAACCAGGAGTGTCAGGTCATGGCTTGTA[T/G]AATGTGAAGAAGGAATGTCTGAAAGAGTTTAACCCCTTTTTCTATCATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23154
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085223 Essential Splice Site 831 870 23 25
Genomic Location:
Chromosome 17 (position 40005085)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGTTTAACCCCTTTTTCTATCATTACTCCAGACCACAGCATAGTAAGG[T/C]ACACAATGCGCCTGTTATCTCATGAACTATATTAGCTTATTAGTGTTGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/u4r1o9pw