pdk3b

Ensembl ID:
ENSDARG00000060460
ZFIN ID:
ZDB-GENE-070112-1892
Description:
pyruvate dehydrogenase kinase, isozyme 3b [Source:RefSeq peptide;Acc:NP_001074157]
Human Orthologue:
PDK3
Human Description:
pyruvate dehydrogenase kinase, isozyme 3 [Source:HGNC Symbol;Acc:8811]
Mouse Orthologue:
Pdk3
Mouse Description:
pyruvate dehydrogenase kinase, isoenzyme 3 Gene [Source:MGI Symbol;Acc:MGI:2384308]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32550 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa32550
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124107 Essential Splice Site 35 415 1 13
Genomic Location (Zv9):
Chromosome Zv9_scaffold3460 (position 89819)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 40566987
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGAGGTTTTCGCCCTCGCCGATGTCAATCAAGCAGTTTCTGGATTTCGG[T/A]GAGTAATGTAACATTACAGCAAAGTCTTGAAGAAGCGTTGCATTATTTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link