LOC797812

Ensembl ID:
ENSDARG00000060459
Human Orthologue:
LRFN2
Human Description:
leucine rich repeat and fibronectin type III domain containing 2 [Source:HGNC Symbol;Acc:21226]
Mouse Orthologue:
Lrfn2
Mouse Description:
leucine rich repeat and fibronectin type III domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:191

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa864 Nonsense Available for shipment Available now
sa42983 Essential Splice Site Mutation detected in F1 DNA During 2016
sa28909 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa864
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085218 Nonsense 251 780 1 2
Genomic Location:
Chromosome 17 (position 40388751)
KASP Assay ID:
554-0766.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGTCTCTCAGCTTTGGTGGGAATCCTCTTCACTGTAATTGTGAGATTT[T/A]ATGGTTGCGACGCCTAGAGAGGGAGGATGATATGGAAACCTGTGCCTCCC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa42983
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085218 Essential Splice Site 459 780 1 2
Genomic Location:
Chromosome 17 (position 40388126)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTACCAGCTGCAATACAACTGTTCGGAGGATGATGTCCTGATTTATAG[G/A]TAAATATTCTATGTTTCCTTTCCTTTAAACAACTGGAGACTGATTAGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28909
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085218 Nonsense 625 780 2 2
Genomic Location:
Chromosome 17 (position 40382021)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAGTAGCATCTCTTCCTCTTCATCCTCCTCAGCAGACACACTTGGATG[T/A]GAGAAAGTAGAGTCCTACAACCGGCATGGCGATTCAAACACCTTGCCTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link