ENSDARG00000060458

Ensembl ID:
ENSDARG00000060458
Human Orthologue:
HRH3
Human Description:
histamine receptor H3 [Source:HGNC Symbol;Acc:5184]
Mouse Orthologue:
Hrh3
Mouse Description:
histamine receptor H3 Gene [Source:MGI Symbol;Acc:MGI:2139279]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5688 Nonsense Mutation detected in F1 DNA Unknown

Mutation Details

Allele Name:
sa5688
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085196 Nonsense 348 398 3 3
Genomic Location:
Chromosome 22 (position 1145002)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGATGATCATAAGGGCAGCCTGCAGTGGTAGCTGTGTGGAGCATCATTG[G/A]TATGAAGTCACATTTTGGCTTCTTTGGCTTAATTCGGCCATCAATCCCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/y7fco1mb