ENSDARG00000060458

Ensembl ID:
ENSDARG00000060458
Human Orthologue:
HRH3
Human Description:
histamine receptor H3 [Source:HGNC Symbol;Acc:5184]
Mouse Orthologue:
Hrh3
Mouse Description:
histamine receptor H3 Gene [Source:MGI Symbol;Acc:MGI:2139279]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43742 Nonsense Mutation detected in F1 DNA During 2016
sa5688 Nonsense Mutation detected in F1 DNA Unknown
sa37396 Nonsense Mutation detected in F1 DNA During 2016
sa37397 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa43742
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085196 Nonsense 294 398 3 3
Genomic Location:
Chromosome 22 (position 1144840)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTTGGGTTCGGACGCGGATTATTCGAGCGCAGGAAGTGACGAATCCCTG[T/A]GCGCCTTGCCGAAGCGGCGGACACGCACGTCTTTCTAGAGATAAGAAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5688
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085196 Nonsense 348 398 3 3
Genomic Location:
Chromosome 22 (position 1145002)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGATGATCATAAGGGCAGCCTGCAGTGGTAGCTGTGTGGAGCATCATTG[G/A]TATGAAGTCACATTTTGGCTTCTTTGGCTTAATTCGGCCATCAATCCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37396
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085196 Nonsense 357 398 3 3
Genomic Location:
Chromosome 22 (position 1145029)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTAGCTGTGTGGAGCATCATTGGTATGAAGTCACATTTTGGCTTCTTTG[G/A]CTTAATTCGGCCATCAATCCCTTCCTGTATCCACTGTGCCACAGCAGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37397
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085196 Nonsense 393 398 3 3
Genomic Location:
Chromosome 22 (position 1145135)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCGTTCGCTAAGATCCTGTGCCCAAAACGGCAGTCTGTTCAACCGCAC[G/T]AGGAAAGCCCTTCATGCCCATGACAGTCTGACAGGGATTTTAACACTGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link