A0PJR0_DANRE

Ensembl ID:
ENSDARG00000060456
Description:
Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:A0PJR0]
Human Orthologue:
NMI
Human Description:
N-myc (and STAT) interactor [Source:HGNC Symbol;Acc:7854]
Mouse Orthologue:
Nmi
Mouse Description:
N-myc (and STAT) interactor Gene [Source:MGI Symbol;Acc:MGI:1928368]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13550 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13550
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085182 Nonsense 164 397 5 9
Genomic Location:
Chromosome 9 (position 58121498)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTCCCGGTGCAGACAGTGAAGTTCTCTGGCAGTASAGGTGTGTGTGAG[C/T]GAGAGGATGAGCTGCGGTGTGTGTTTAYGGTCACTCAGCGTCCGTCACTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9hiybx3o