sdk2b

Ensembl ID:
ENSDARG00000060452
ZFIN ID:
ZDB-GENE-030131-8203
Description:
Novel protein similar to vertebrate sidekick homolog family (Chicken) [Source:UniProtKB/TrEMBL;Acc:B
Human Orthologue:
SDK2
Human Description:
sidekick homolog 2 (chicken) [Source:HGNC Symbol;Acc:19308]
Mouse Orthologue:
Sdk2
Mouse Description:
sidekick homolog 2 (chicken) Gene [Source:MGI Symbol;Acc:MGI:2443847]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31893 Nonsense Available for shipment Available now
sa38902 Nonsense Mutation detected in F1 DNA During 2017
sa12667 Nonsense Available for shipment Available now
sa24919 Essential Splice Site Mutation detected in F1 DNA During 2017
sa1344 Essential Splice Site Available for shipment Available now
sa35360 Nonsense Mutation detected in F1 DNA During 2017
sa35359 Nonsense Mutation detected in F1 DNA During 2017
sa2625 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa31893
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085121 Nonsense 367 2254 9 46
ENSDART00000140353 Nonsense 321 2035 8 44
Genomic Location (Zv9):
Chromosome 12 (position 39108379)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 37395793
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTCTCTTTTCCTTTTGATTTCAGGTGTTCCTCAGCCTGATATTGTGTG[G/A]TATAAAGATGCAGTTCCCATAAGCCCTGTGAAGACGCCGCGCTACAGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38902
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085121 Nonsense 795 2254 17 46
ENSDART00000140353 Nonsense 749 2035 16 44
Genomic Location (Zv9):
Chromosome 12 (position 39082800)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 37370214
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGAGGATCTCATCATCTGGACTAATTATGAAATCGAAGTGGCGGCTTA[T/G]AATGGAGCTGGACTGGGGGTTTACTGTCATAAAGTTACAGAGTGGACACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12667
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085121 Nonsense 989 2254 21 46
ENSDART00000140353 Nonsense 943 2035 20 44
Genomic Location (Zv9):
Chromosome 12 (position 39073661)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 37361075
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACGTGACTCTGGAGTACCGAGYGACCGGACTGACGGCTCTCACCACATA[C/A]ACCATTGAGGTGGCAGCCATGACCTCTAAAGGCCAGGGTCAGCTGTCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24919
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085121 Essential Splice Site 1261 2254 26 46
ENSDART00000140353 Essential Splice Site 1214 2035 25 44
Genomic Location (Zv9):
Chromosome 12 (position 39060374)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 37347788
KASP Assay ID:
554-7540.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTTTGAAGTTCCGGAACCTGACCGGAATGGACTCATCCTAGGATATAAG[G/A]TCAGTGAGGAATTAAAATTAAACTAAAGGGTGTGATACAACAGACTGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1344
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085121 Essential Splice Site 1422 2254 29 46
ENSDART00000140353 Essential Splice Site 1375 2035 28 44
Genomic Location (Zv9):
Chromosome 12 (position 39058230)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 37345644
KASP Assay ID:
554-1258.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGATGGGGAGAGGCGGCGGAAGCCTTAGTCGTCACTACCGAGAAGAGAG[G/A]TAATCTACATTATTATCACACATCAACAATGGGGAAAAACAAACTCAAAC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa35360
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085121 Nonsense 1469 2254 30 46
ENSDART00000140353 Nonsense 1422 2035 29 44
Genomic Location (Zv9):
Chromosome 12 (position 39052970)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 37340384
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGTTTATCGCCAATCCGTTATTACACGGTTCAGGTCCGCGAGCTGCCC[G/T]AGAAGAACTGGACAGTGCATTCTGCCTCTGTCAGCCACGAGTCCAGCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35359
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085121 Nonsense 1892 2254 40 46
ENSDART00000140353 Nonsense 1826 2035 39 44
Genomic Location (Zv9):
Chromosome 12 (position 39034756)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 37322170
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACGATATGGCTCCGCCCTCACCATCCACTGGGCCAATGGGGACCCTGGA[C/T]GAGCACCAATCACACGCTATGTTATTGAAGCCAGACCCTCAGGTGAGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2625
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085121   2118 2254 46 46
ENSDART00000140353 Nonsense 2034 2035 44 44
Genomic Location (Zv9):
Chromosome 12 (position 39001852)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 37289266
KASP Assay ID:
554-2444.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
WGTTCGCTCTCCATTTCTCACCCGTTCCCTTTCTTTCCACTGTAGGGCAG[C/T]GACAGTGAATATGAGGTGGACCCCAACCGYCAGAAGACCCATTCCTTTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link