im:7154960

Ensembl ID:
ENSDARG00000060442
ZFIN ID:
ZDB-GENE-080225-14
Human Orthologue:
C19orf6
Human Description:
chromosome 19 open reading frame 6 [Source:HGNC Symbol;Acc:17039]
Mouse Orthologue:
ORF61
Mouse Description:
open reading frame 61 Gene [Source:MGI Symbol;Acc:MGI:2177957]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14860 Nonsense Available for shipment Available now
sa35049 Nonsense Mutation detected in F1 DNA During 2016
sa5840 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa14860
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085158 Nonsense 253 694 4 11
Genomic Location:
Chromosome 11 (position 14325930)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGAATATTCTTTGGAATATGGTTTCCTAAGGCTATCCCAGGCCACACGT[C/T]AACGACTCAACATCCCTGTTATGGTGGTGACCCTTGGTAAGTATTGATNNCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35049
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085158 Nonsense 254 694 4 11
Genomic Location:
Chromosome 11 (position 14325927)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATATTCTTTGGAATATGGTTTCCTAAGGCTATCCCAGGCCACACGTCAA[C/T]GACTCAACATCCCTGTTATGGTGGTGACCCTTGGTAAGTATTGATCCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5840
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085158 Essential Splice Site 306 694 5 11
Genomic Location:
Chromosome 11 (position 14323058)
KASP Assay ID:
554-3951.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTCTAATGTCCAGTGTGAAGGCATTAGCAGAGAATGAGGAAAACAAAGG[T/C]AAACAATTACGTGTTCTCCCAAAAGATCAGTGCTTCCTTCTTGAGTGCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link