im:7154960

Ensembl ID:
ENSDARG00000060442
ZFIN ID:
ZDB-GENE-080225-14
Human Orthologue:
C19orf6
Human Description:
chromosome 19 open reading frame 6 [Source:HGNC Symbol;Acc:17039]
Mouse Orthologue:
ORF61
Mouse Description:
open reading frame 61 Gene [Source:MGI Symbol;Acc:MGI:2177957]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14860 Nonsense Available for shipment Available now
sa5840 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa14860
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085158 Nonsense 253 694 4 11
Genomic Location:
Chromosome 11 (position 14325930)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGAATATTCTTTGGAATATGGTTTCCTAAGGCTATCCCAGGCCACACGT[C/T]AACGACTCAACATCCCTGTTATGGTGGTGACCCTTGGTAAGTATTGATNNCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5840
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085158 Essential Splice Site 306 694 5 11
Genomic Location:
Chromosome 11 (position 14323058)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTCTAATGTCCAGTGTGAAGGCATTAGCAGAGAATGAGGAAAACAAAGG[T/C]AAACAATTACGTGTTCTCCCAAAAGATCAGTGCTTCCTTCTTGAGTGCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/q9r5y61d