im:6903943

Ensembl ID:
ENSDARG00000060439
ZFIN ID:
ZDB-GENE-050506-73
Human Orthologue:
CLCN2
Human Description:
chloride channel 2 [Source:HGNC Symbol;Acc:2020]
Mouse Orthologue:
Clcn2
Mouse Description:
chloride channel 2 Gene [Source:MGI Symbol;Acc:MGI:105061]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42631 Nonsense Mutation detected in F1 DNA During 2017
sa36004 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42631
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085136 Nonsense 102 810 4 23
Genomic Location (Zv9):
Chromosome 15 (position 46113976)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 46535594
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCCCACAGGTGGATCTACTACAGTGTGGCGGATTATCATGTTGTGGTG[C/T]AGTATCTGGTGTGGGTCTCATATTCCATGATCCTCATGTGTTTCGCTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36004
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085136 Nonsense 598 810 17 23
Genomic Location (Zv9):
Chromosome 15 (position 46093469)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 46515087
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTTTGACTGTGTTTCTCAGAGTCGATGCTGCTTTTGGGCTCTATTGAG[C/T]GAGCTCAGTTGTTGGCGCTCCTGATAGAGCGAACGCAATACCTGCGGGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link