tbl1x

Ensembl ID:
ENSDARG00000060438
ZFIN ID:
ZDB-GENE-070209-131
Description:
F-box-like/WD repeat-containing protein TBL1X [Source:RefSeq peptide;Acc:NP_001076463]
Human Orthologues:
TBL1X, TBL1Y
Human Descriptions:
transducin (beta)-like 1, Y-linked [Source:HGNC Symbol;Acc:18502]
transducin (beta)-like 1X-linked [Source:HGNC Symbol;Acc:11585]
Mouse Orthologue:
Tbl1x
Mouse Description:
transducin (beta)-like 1 X-linked Gene [Source:MGI Symbol;Acc:MGI:1336172]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11514 Nonsense Available for shipment Available now
sa3742 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa11514
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085135 Nonsense 227 510 6 15
Genomic Location:
Chromosome 9 (position 57111465)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCCGAGAGGGAGGACAGGAYGTGCCCAGCAACAAAGATGTCACWTCTT[T/A]AGACTGGAACGTGAGTGTGAAGCTGAACTATTGATGTTTTAAAATAAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3742
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085135 Essential Splice Site 370 510 11 15
Genomic Location:
Chromosome 9 (position 57105482)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCGTCGGGGATGCTGCTCGCTTCCTGTTCAGATGACATGACTTTAAAGG[T/G]AGACATTTTTCACACATGCTAATATTCTTAATTTTTACCCACATTTCTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/enc3et6l