EML6

Ensembl ID:
ENSDARG00000060437
Description:
echinoderm microtubule associated protein like 6 [Source:HGNC Symbol;Acc:35412]
Human Orthologue:
EML6
Human Description:
echinoderm microtubule associated protein like 6 [Source:HGNC Symbol;Acc:35412]
Mouse Orthologue:
Eml6
Mouse Description:
echinoderm microtubule associated protein like 6 Gene [Source:MGI Symbol;Acc:MGI:2442895]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5847 Nonsense Mutation detected in F1 DNA During 2014
sa17299 Nonsense Available for shipment Available now
sa21979 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa5847
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085150 Nonsense 531 1866 14 45
Genomic Location:
Chromosome 11 (position 44061482)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAACAGTGGAGAATCAGACTCGGATCTGTCAGACGTCYCGGAGCTGGACT[C/A]RGACATCGAGCAGGAGGCTCAGATCAGCTACGAGCGGCAGGCAAGAGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17299
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085150 Nonsense 1040 1866 27 45
Genomic Location:
Chromosome 11 (position 44040432)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTGAAGKAAYGAAAGGTTTTTGTGTGCGTTATTGCAGGAAAACTGCTT[C/T]AAGTCAACACTGGTGCCAAAGAGCAGCTCTTTTTYGAAGCTCCGCGCGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21979
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085150 Nonsense 1095 1866 28 45
Genomic Location:
Chromosome 11 (position 44040167)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGTGGCACCTGTGAGGGCATCTGGCCGACTCTGAGTTTGGTCAACGCCT[C/A]GTCTCTCACCAAAGACAAGAAGCTTCTGGCCACTGGAGACGACTTCGGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/kov5qv8b