bnipl

Ensembl ID:
ENSDARG00000060435
ZFIN ID:
ZDB-GENE-060503-81
Description:
bcl-2/adenovirus E1B 19 kDa-interacting protein 2-like protein [Source:RefSeq peptide;Acc:NP_001121
Human Orthologue:
BNIPL
Human Description:
BCL2/adenovirus E1B 19kD interacting protein like [Source:HGNC Symbol;Acc:16976]
Mouse Orthologue:
Bnipl
Mouse Description:
BCL2/adenovirus E1B 19kD interacting protein like Gene [Source:MGI Symbol;Acc:MGI:2384749]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39123 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39123
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085143 Nonsense 283 361 7 10

The following transcripts of ENSDARG00000060435 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 40956753)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 38341553
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTGTGTGGAATGGCTCCTCGCAATAAGATGCCTGGCATTAAGTGGCTG[C/T]GACAGTGTTACATGTCCATTGACAGAAGGTGAGTCGTACTAAAGGTTATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link