NP_001121673.1

Ensembl ID:
ENSDARG00000060434
Description:
microtubule-associated protein 1B [Source:RefSeq peptide;Acc:NP_001121673]
Human Orthologue:
MAP1B
Human Description:
microtubule-associated protein 1B [Source:HGNC Symbol;Acc:6836]
Mouse Orthologue:
Mtap1b
Mouse Description:
microtubule-associated protein 1B Gene [Source:MGI Symbol;Acc:MGI:1306778]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40489 Nonsense Mutation detected in F1 DNA During 2017
sa16322 Nonsense Available for shipment Available now
sa17173 Nonsense Available for shipment Available now
sa40488 Nonsense Mutation detected in F1 DNA During 2017
sa16946 Nonsense Available for shipment Available now
sa33650 Nonsense Mutation detected in F1 DNA During 2017
sa33649 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40489
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085142 Nonsense 130 2033 4 7
ENSDART00000114399 Nonsense 130 1976 4 9
Genomic Location (Zv9):
Chromosome 5 (position 36898960)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 34680909
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTACATAAATAGTATAAACTCTGTTTACACCTAGGTACGGCTAATGGTCT[C/A]AGACACAGCCCATCATAAGCTGCTTGTCCTGGCAGGACAGTGCTTTGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16322
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085142 Nonsense 505 2033 5 7
ENSDART00000114399 Nonsense 505 1976 5 9
Genomic Location (Zv9):
Chromosome 5 (position 36897421)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 34679370
KASP Assay ID:
2259-6146.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTTTTTCCAGGCAATTCTACTCAGAATCATATTCTAGAAGGCCTAGAA[A/T]AACTTAAACACTTAGACTTCCTCAAATATCCTGTGATCACACAAAATGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17173
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085142 Nonsense 753 2033 5 7
ENSDART00000114399 Nonsense 694 1976 7 9
Genomic Location (Zv9):
Chromosome 5 (position 36896677)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 34678626
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCCTGGTAGCCCTGCCAGATCTAAAGACAAGGCCAAGTCCAAGCCCACC[A/T]AAAAAGATGCAGGAGAATCAGTGGCAGCACCTWCCGTCTCAGGAGCCACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40488
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085142 Nonsense 1029 2033 5 7
ENSDART00000114399 Nonsense 970 1976 7 9
Genomic Location (Zv9):
Chromosome 5 (position 36895849)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 34677798
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAAATGTCAACTCCAAGAGATGTAATGAGTGATGAGACAACTAATGAT[G/T]AAAGCGATTCTCCTTCCCAAGATTTTGTCAGGTACGGTATAACTACAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16946
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085142 Nonsense 1248 2033 5 7
ENSDART00000114399 Nonsense 1189 1976 7 9
Genomic Location (Zv9):
Chromosome 5 (position 36895192)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 34677141
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATCACCAATTTATGAAGCACACTTRTCGACCAATTTTGAATTTGACAGC[A/T]AATTGCCAAGTCARACTGACAATAGTGATAAAAAAATWGCAACTGATGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33650
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085142 Nonsense 1665 2033 5 7
ENSDART00000114399 Nonsense 1606 1976 7 9
Genomic Location (Zv9):
Chromosome 5 (position 36893941)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 34675890
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACTCTAGATAAATTTTCCACCAGCTCTTCATCATATTCATACAGTTGT[C/T]AAAATGTAGAATCTACTCAAATCTGTGATGGTGGGTCCATTGGACCAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33649
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085142 Nonsense 1691 2033 5 7
ENSDART00000114399 Nonsense 1632 1976 7 9
Genomic Location (Zv9):
Chromosome 5 (position 36893863)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 34675812
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGTGGGTCCATTGGACCAGAAACCTCAAAAGCATGCCATTCTCAGTCA[C/T]GAGCAGAAGTGGACTTGTGTTTGGTGACCTCCTGTGAATACAGACATCCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link