si:ch211-1o14.5

Ensembl ID:
ENSDARG00000060415
ZFIN ID:
ZDB-GENE-060531-28
Description:
Novel protein similar to vertebrate rho/rac guanine nucleotide exchange factor (GEF) 18 (ARHGEF18) [
Human Orthologue:
RP11-428C6.1
Human Description:
Rho-guanine nucleotide exchange factor [Source:UniProtKB/Swiss-Prot;Acc:Q8N1W1]
Mouse Orthologue:
Rgnef
Mouse Description:
Rho-guanine nucleotide exchange factor Gene [Source:MGI Symbol;Acc:MGI:1346016]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa26519 Nonsense Mutation detected in F1 DNA During 2017
sa20469 Nonsense Available for shipment Available now
sa40486 Essential Splice Site Mutation detected in F1 DNA During 2017
sa26517 Nonsense Mutation detected in F1 DNA During 2017
sa16048 Nonsense Available for shipment Available now
sa40485 Essential Splice Site, Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa26519
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085086 Nonsense 23 944 1 24
ENSDART00000133170 Nonsense 318 1326 7 25
Genomic Location (Zv9):
Chromosome 5 (position 36493654)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 34275603
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAAGTACAAAGTCAGCCGCACATTCAGCTTCATAAAGAGCCGAATGTA[T/G]AGCACTCGCAACAAGAACAAGGTAAATATTGCATACAGTACATGAAATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20469
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085086 Nonsense 394 944 13 24
ENSDART00000133170 Nonsense 666 1326 15 25
Genomic Location (Zv9):
Chromosome 5 (position 36483489)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 34265438
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTACTTCAAAGAGCTTCAGCAGCAGAACAAGAGATTTCAGCTCTTCATC[A/T]AAGTGAGAGACCCATCAACCAATACTTTATAAGTCGAATATTAATGCATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40486
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085086 Essential Splice Site 518 944 15 24
ENSDART00000133170 Essential Splice Site 790 1326 17 25
Genomic Location (Zv9):
Chromosome 5 (position 36482921)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 34264870
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCACCAGGGCCCGCTGCTCTGGAAGACAGCCACTGGAAGACTGAAAGG[T/G]CAGACTGACAACACTTAATACAATATTTAACATAAAAGATATTGTGCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26517
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085086 Nonsense 552 944 17 24
ENSDART00000133170 Nonsense 824 1326 19 25
Genomic Location (Zv9):
Chromosome 5 (position 36480518)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 34262467
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGTCGTCTTGCTGTATTTGTCAGGACCAGAAGCCTCCAGTGATCTCTT[T/A]GCAGAAACTAATTGTGCGTGAGGTGGCCAATGAAGAGAGAGGCATGTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16048
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085086 Nonsense 672 944 20 24
ENSDART00000133170 Nonsense 947 1326 21 25
Genomic Location (Zv9):
Chromosome 5 (position 36477124)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 34259073
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTGATGGCAGGCCAGCGAGAGGCAGGACCAGAGCCCAGGCTGCTGGTA[C/T]GACCCAGCACTGAAGACRTTCCCCAGGCKGGAGTACTACTCAGCGCCGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40485
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085086 Essential Splice Site 782 944 23 24
ENSDART00000133170 Splice Site None 1326 None 25
Genomic Location (Zv9):
Chromosome 5 (position 36469853)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 34251802
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGTTTTGGTGTAATGTTTCATAACTTTCTGTCACTCAGTGTTTTTGTTT[G/A]TTTGCAGGTGAGTCAGAGTGTGCAGAGCTTGACTCAGCTGCTGTACAGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link