si:ch211-124n19.2

Ensembl ID:
ENSDARG00000060401
ZFIN ID:
ZDB-GENE-081104-105
Description:
Novel prptein similar to vertebrate SH3 domain containing ring finger 1 (SH3RF1) [Source:UniProtKB/T
Human Orthologue:
SH3RF3
Human Description:
SH3 domain containing ring finger 3 [Source:HGNC Symbol;Acc:24699]
Mouse Orthologue:
Sh3rf3
Mouse Description:
SH3 domain containing ring finger 3 Gene [Source:MGI Symbol;Acc:MGI:2444637]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14831 Nonsense Mutation detected in F1 DNA During 2017
sa41560 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa14831
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085042 Nonsense 11 675 1 17
ENSDART00000133366 Nonsense 8 138 1 2
ENSDART00000134648   None 164 None 2
ENSDART00000138876   None 57 None 1
Genomic Location (Zv9):
Chromosome 9 (position 57606795)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 56596617
KASP Assay ID:
1641-0506.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGTTCATGTGTGYTYTCTCTCTCACAGGATGAGATTCTGACYGTCRTA[C/T]GAAGAGTRGACGATAACTGGGCAGAAGGCATGCTGGGAGATAAAATYGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41560
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085042 Essential Splice Site 158 675 3 17
ENSDART00000133366   None 138 None 2
ENSDART00000134648   None 164 None 2
ENSDART00000138876   None 57 None 1
Genomic Location (Zv9):
Chromosome 9 (position 57589619)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 56579441
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTGCGCCCCTGCCTCCAGCACAGCTGCTGCACAGGTACAGCACACATG[T/A]ATGTCTGCATCAAGCGGCAACCTCCTGGTCTCCCTTGGGTAGCCAATTCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link