LOC100329977

Ensembl ID:
ENSDARG00000060400
Human Orthologue:
GPR12
Human Description:
G protein-coupled receptor 12 [Source:HGNC Symbol;Acc:4466]
Mouse Orthologue:
Gpr12
Mouse Description:
G-protein coupled receptor 12 Gene [Source:MGI Symbol;Acc:MGI:101909]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4969 Nonsense Mutation detected in F1 DNA During 2014
sa16140 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa4969
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085071 Nonsense 280 332 1 1
Genomic Location:
Chromosome 21 (position 41968249)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCTTGCCATGTATTCGCTGGTGGCGGACACGCGGTCGCCCGTGATTTA[C/A]ACGTACGTCACAGCTCTTCCAGCAATCTGCCACTCCATCATCAACCCTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16140
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085071 Nonsense 308 332 1 1
Genomic Location:
Chromosome 21 (position 41968331)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTCCATCATCAACCCTATGGTATATGCATTYAGGAACCCGGAGATTCTC[C/T]GATCTTTGAGGATTGCTTGTTGTGGRTGCATGCCKTATAGTTTCAGCRTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/g6ftvchi