hhip

Ensembl ID:
ENSDARG00000060397
ZFIN ID:
ZDB-GENE-030131-4827
Description:
hedgehog-interacting protein [Source:RefSeq peptide;Acc:NP_001073481]
Human Orthologue:
HHIP
Human Description:
hedgehog interacting protein [Source:HGNC Symbol;Acc:14866]
Mouse Orthologue:
Hhip
Mouse Description:
Hedgehog-interacting protein Gene [Source:MGI Symbol;Acc:MGI:1341847]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19529 Essential Splice Site Available for shipment Available now
sa39643 Essential Splice Site Mutation detected in F1 DNA During 2017
sa32711 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa19529
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085051 Essential Splice Site 90 693 1 13
Genomic Location (Zv9):
Chromosome 1 (position 35498878)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 35058736
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCGTCCAGGAGGGCTCCGTATCAGATACTGCATCGGAAAGATGCTCGGG[T/C]ATGTTCGGGCTTCCTGCAGCTTCTAATGATTCTCGTGTTTGTGTGTGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39643
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085051 Essential Splice Site 378 693 6 13
Genomic Location (Zv9):
Chromosome 1 (position 35520034)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 35079892
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGATGGCATGATCACTTTGGACAATATGGAGGAGATGGATGGTCTAAG[G/A]TACATTATTGAATGCTTTAGCTGTGGTAATTTAGCCACTATTGATAAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32711
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085051 Nonsense 406 693 7 13
Genomic Location (Zv9):
Chromosome 1 (position 35520240)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 35080098
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACACAGAATGTTGTAGTACTCCCTACTCCATACCCAGAAACAATCCCTA[T/A]TTTAACAGCACAAATCAACCCCCCGAAATTTTTGCCCATGGTCTGCATGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link