si:dkey-127k13.1

Ensembl ID:
ENSDARG00000060395
ZFIN ID:
ZDB-GENE-070912-368
Description:
LOC100007612 protein [Source:UniProtKB/TrEMBL;Acc:A8WFX2]
Human Orthologues:
MUM1, MUM1L1
Human Descriptions:
melanoma associated antigen (mutated) 1 [Source:HGNC Symbol;Acc:29641]
melanoma associated antigen (mutated) 1-like 1 [Source:HGNC Symbol;Acc:26583]
Mouse Orthologues:
DXBay18, Gm14685, Gm5640, Gm5936, Mum1, Mum1l1
Mouse Descriptions:
DNA segment, Chr X, Baylor 18 Gene [Source:MGI Symbol;Acc:MGI:99870]
melanoma associated antigen (mutated) 1 Gene [Source:MGI Symbol;Acc:MGI:1915364]
melanoma associated antigen (mutated) 1-like 1 Gene [Source:MGI Symbol;Acc:MGI:2445062]
predicted gene 14685 Gene [Source:MGI Symbol;Acc:MGI:3710618]
predicted gene 5640 Gene [Source:MGI Symbol;Acc:MGI:3645126]
predicted gene 5936 Gene [Source:MGI Symbol;Acc:MGI:3645575]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38342 Essential Splice Site Mutation detected in F1 DNA During 2017
sa39885 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38342
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085046 Essential Splice Site 767 1140 7 17
ENSDART00000146820 Essential Splice Site 185 558 3 13

The following transcripts of ENSDARG00000060395 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 37178635)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 37475345
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAGTAGTCCTTGCTCTGAAAATCAGGAACCAGAGCCTAATGAGTCGGG[T/A]ATATTTGTATATTTCATGTATATCAAGTGAAATATCAGGCATAAAACAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39885
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085046 Nonsense 813 1140 8 17
ENSDART00000146820 Nonsense 231 558 4 13

The following transcripts of ENSDARG00000060395 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 37176567)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 37473277
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAGATGATCAGGATGATGATGACGATGACGAGGAGCTGCCCAGCTTTT[T/A]GGGGCAGGACAGTAAAAGTGAGTGAGCAATAAAAGTGTAGATAAAAATAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link