si:dkey-127k13.1

Ensembl ID:
ENSDARG00000060395
ZFIN ID:
ZDB-GENE-070912-368
Description:
LOC100007612 protein [Source:UniProtKB/TrEMBL;Acc:A8WFX2]
Human Orthologues:
MUM1, MUM1L1
Human Descriptions:
melanoma associated antigen (mutated) 1 [Source:HGNC Symbol;Acc:29641]
melanoma associated antigen (mutated) 1-like 1 [Source:HGNC Symbol;Acc:26583]
Mouse Orthologues:
DXBay18, Gm14685, Gm5640, Gm5936, Mum1, Mum1l1
Mouse Descriptions:
DNA segment, Chr X, Baylor 18 Gene [Source:MGI Symbol;Acc:MGI:99870]
melanoma associated antigen (mutated) 1 Gene [Source:MGI Symbol;Acc:MGI:1915364]
melanoma associated antigen (mutated) 1-like 1 Gene [Source:MGI Symbol;Acc:MGI:2445062]
predicted gene 14685 Gene [Source:MGI Symbol;Acc:MGI:3710618]
predicted gene 5640 Gene [Source:MGI Symbol;Acc:MGI:3645126]
predicted gene 5936 Gene [Source:MGI Symbol;Acc:MGI:3645575]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44540 Nonsense Mutation detected in F1 DNA During 2017
sa38342 Essential Splice Site Mutation detected in F1 DNA During 2017
sa39885 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44540
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085046 Nonsense 681 1140 6 17
ENSDART00000146820 Nonsense 99 558 2 13

The following transcripts of ENSDARG00000060395 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 37178980)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTCCTCTCCTAAGCTCCACCCCAAGCTCTCATCTCCAACCCCTGACAT[C/A]AAAAAGAGAAGACAATAATCCAGCACCAAATGCCACAAAGTCTAGACTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38342
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085046 Essential Splice Site 767 1140 7 17
ENSDART00000146820 Essential Splice Site 185 558 3 13

The following transcripts of ENSDARG00000060395 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 37178635)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 37475345
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAGTAGTCCTTGCTCTGAAAATCAGGAACCAGAGCCTAATGAGTCGGG[T/A]ATATTTGTATATTTCATGTATATCAAGTGAAATATCAGGCATAAAACAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39885
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085046 Nonsense 813 1140 8 17
ENSDART00000146820 Nonsense 231 558 4 13

The following transcripts of ENSDARG00000060395 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 37176567)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 37473277
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAGATGATCAGGATGATGATGACGATGACGAGGAGCTGCCCAGCTTTT[T/A]GGGGCAGGACAGTAAAAGTGAGTGAGCAATAAAAGTGTAGATAAAAATAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link