ash2l

Ensembl ID:
ENSDARG00000060392
ZFIN ID:
ZDB-GENE-030131-494
Description:
ash2-like [Source:RefSeq peptide;Acc:NP_001103575]
Human Orthologue:
ASH2L
Human Description:
ash2 (absent, small, or homeotic)-like (Drosophila) [Source:HGNC Symbol;Acc:744]
Mouse Orthologue:
Ash2l
Mouse Description:
ash2 (absent, small, or homeotic)-like (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1344416]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17333 Essential Splice Site Available for shipment Available now
sa17111 Essential Splice Site Available for shipment Available now
sa21633 Essential Splice Site Mutation detected in F1 DNA During 2014
sa21632 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa17333
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085031 Essential Splice Site 38 590 2 17
ENSDART00000124356 Essential Splice Site 38 463 2 12
ENSDART00000131749 Essential Splice Site 36 277 2 10

The following transcripts of ENSDARG00000060392 do not overlap with this mutation:

Genomic Location:
Chromosome 10 (position 2813210)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
WCTGACCRCAAACATGGAGACCGAGTCGTCCAGTGGAAAGGAGACTATGG[T/C]ACTGWAGGATATTTGACACATGAGGAGTTGAACTTTCTAYAATTTCMACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17111
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085031 Essential Splice Site 180 590 6 17
ENSDART00000124356 Essential Splice Site 180 463 6 12
ENSDART00000131749 Essential Splice Site 178 277 6 10

The following transcripts of ENSDARG00000060392 do not overlap with this mutation:

Genomic Location:
Chromosome 10 (position 2805812)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGAGACCCGGCAAACTAACATGGCCAAATAACATCGTCAAAAYCATGG[T/G]GAGTTATTTGAATCTTTTATTATTTTATTRTCRGTCAATAATTTGGTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21633
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085031 Essential Splice Site 244 590 None 17
ENSDART00000124356 None None 463 None 12
ENSDART00000131749 Essential Splice Site 248 277 None 10

The following transcripts of ENSDARG00000060392 do not overlap with this mutation:

Genomic Location:
Chromosome 10 (position 2802788)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTCCTGTAAAGCTGTGCGTTGTATTCCAGGTGGATCAACCTTTTCAGG[T/G]GACTATGAGGTGTTTTACATGTGGCTTTTGAAACGGGAGGCTGGTGTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21632
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085031 Nonsense 495 590 14 17
ENSDART00000124356 None None 463 None 12
ENSDART00000131749 None None 277 None 10

The following transcripts of ENSDARG00000060392 do not overlap with this mutation:

Genomic Location:
Chromosome 10 (position 2792240)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTACTTATACTTTGAAGAGAAAGATTATGTGGACAAGGCTGAGAAGAACT[T/A]GAAACCCACCAGTACCAGCAGAGTGAGTCATTCAAGACATTTTTTATATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3hwmg23g