ttll11

Ensembl ID:
ENSDARG00000060374
ZFIN ID:
ZDB-GENE-061013-747
Description:
tubulin tyrosine ligase-like family, member 11 [Source:RefSeq peptide;Acc:NP_001070843]
Human Orthologue:
TTLL11
Human Description:
tubulin tyrosine ligase-like family, member 11 [Source:HGNC Symbol;Acc:18113]
Mouse Orthologue:
Ttll11
Mouse Description:
tubulin tyrosine ligase-like family, member 11 Gene [Source:MGI Symbol;Acc:MGI:1921660]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6988 Nonsense Mutation detected in F1 DNA During 2014
sa20468 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6988
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085684 Nonsense 280 723 4 9
ENSDART00000111269 Nonsense 281 724 4 9
Genomic Location:
Chromosome 5 (position 35254321)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGAYTCCATTCTCAAACCCACCTTCATCGTCAAACCGGACAGTGGATCC[C/T]AAGGGGATGGCATCTACCTCATCCGYGACCCTGCTGACCTTCGGGTGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20468
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085684 Nonsense 693 723 9 9
ENSDART00000111269 Nonsense 694 724 9 9
Genomic Location:
Chromosome 5 (position 35286678)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACTGACAAGCCACGGCCACAGAAATCACACACAAACCCCGGCCCTATG[C/T]AACCATCAGCGCCAAACACGTTCAGTTCTCCTGCACTAATGCGCCGCCGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/v3las6g3