si:dkey-164k14.1

Ensembl ID:
ENSDARG00000060372
ZFIN ID:
ZDB-GENE-090311-6
Description:
Plexin A2 [Source:UniProtKB/TrEMBL;Acc:B6E521]
Human Orthologues:
PLXNA2, PLXNC1, PLXND1
Human Descriptions:
plexin A2 [Source:HGNC Symbol;Acc:9100]
plexin C1 [Source:HGNC Symbol;Acc:9106]
plexin D1 [Source:HGNC Symbol;Acc:9107]
Mouse Orthologues:
Plxna2, Plxnc1, Plxnd1
Mouse Descriptions:
plexin A2 Gene [Source:MGI Symbol;Acc:MGI:107684]
plexin C1 Gene [Source:MGI Symbol;Acc:MGI:1890127]
plexin D1 Gene [Source:MGI Symbol;Acc:MGI:2154244]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37759 Nonsense Mutation detected in F1 DNA During 2017
sa12731 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37759
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084985 Nonsense 293 553 5 11
ENSDART00000147998 Nonsense 1353 1850 21 31
Genomic Location (Zv9):
Chromosome 23 (position 32849942)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 32709740
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCGTGATCGCGGTAACGTGGCGTCGCTCATCATGACGGCTCTACAGGGT[C/T]GACTGGAATACGCCACGGACGTCCTCAAACACCTGCTGTCCGACCTCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12731
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084985 Nonsense 423 553 8 11
ENSDART00000147998 Nonsense 1483 1850 24 31
Genomic Location (Zv9):
Chromosome 23 (position 32835411)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 32695209
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAACAGCCCRGAGATCCCGGTCAAGGTTTTGAACTGTGACACCATCACG[C/T]AAGTCAAGGAAAAGATTCTGRATGCTGTGTATAAAAACWTGCCGTATTCW
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Cardiac hypertrophy: Hypertrophy-associated polymorphisms ascertained in a founder cohort applied to heart failure risk and mortality. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link