nadkb

Ensembl ID:
ENSDARG00000060362
ZFIN ID:
ZDB-GENE-061103-433
Description:
NAD kinase b [Source:RefSeq peptide;Acc:NP_001073471]
Human Orthologue:
NADK
Human Description:
NAD kinase [Source:HGNC Symbol;Acc:29831]
Mouse Orthologue:
Nadk
Mouse Description:
NAD kinase Gene [Source:MGI Symbol;Acc:MGI:2183149]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11415 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11415
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084972 Nonsense 83 472 2 12
ENSDART00000135340   None 252 None 7
ENSDART00000137598 Nonsense 83 472 2 12
ENSDART00000139459   None 230 None 7
Genomic Location (Zv9):
Chromosome 2 (position 37001201)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 37297911
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAATCAGCTGAAGACACTTYCGACAGTTGCCYGAAAAGATGGGATAGGTG[C/A]AGGTACAAAATATGCCATTAANGACCTGTTTTACTTTTAATAAAAAATGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link